View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19713_high_29 (Length: 214)

Name: NF19713_high_29
Description: NF19713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19713_high_29
NF19713_high_29
[»] chr7 (1 HSPs)
chr7 (20-199)||(4170315-4170494)


Alignment Details
Target: chr7 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 20 - 199
Target Start/End: Complemental strand, 4170494 - 4170315
Alignment:
20 cattattgggttgatattacagaatctggaattggttcgatcggtgggcttcgttgcaagtcgtttcgcgcaactttagctttgtaccgttaattttccg 119  Q
    ||||||||||||||||||||||||||||||||||||||| | |||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||    
4170494 cattattgggttgatattacagaatctggaattggttcgtttggtgggcttcattgcaagtcgtttcgcgcaacttcagctttgtaccgttaattttccg 4170395  T
120 ggttgttgcttcattgttccactgttatgtgttaactggtgttcgatgctgtttctttgaaagtgtgtatacaatctgtg 199  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
4170394 ggttgttgcttcattgttccactgttatgtgttaactgatgttcgatgctgtttctttgaaagtgtgtatacaatctgtg 4170315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University