View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19713_low_12 (Length: 366)
Name: NF19713_low_12
Description: NF19713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19713_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 326; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 326; E-Value: 0
Query Start/End: Original strand, 9 - 351
Target Start/End: Original strand, 5466362 - 5466706
Alignment:
| Q |
9 |
ttatactcttgaaaaatgttatcagataatattgcattatttttgcttagtcatcaagggttata--tgcatactcacatctttccatttaacgaaactt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5466362 |
ttatactcttgaaaaatgttatcagataatattgcattatttttgcttagtcatcaagggttatatatgcatactcacatctttccatttaacgaaactt |
5466461 |
T |
 |
| Q |
107 |
gaatttcgtactactcttctcaagtttagtatgttttatgatgtcgcgtgttattctgattctctccgtgccctcttattgtaacagggccgaagcaaca |
206 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
5466462 |
gaatttcatactactcttctcaagtttagtatgttttatgatgtcgcgtgttattctgattctctccgtgccctcttattgtaacagggctgaagcaaca |
5466561 |
T |
 |
| Q |
207 |
caacgcaagtttgttatagcgaaagctttactatgcaaggcagacatttcttcttttgacagacttcgacaacaggttggtttgaatatttttgatagca |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5466562 |
caacgcaagtttgttatagcgaaagctttactatgcaaggcagacatttcttcttttgacagacttcgacaacaggttggtttgaatatttttgatagca |
5466661 |
T |
 |
| Q |
307 |
agatgtctcatcttaaaggaaacgttgtgttcataccctacattg |
351 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5466662 |
agatgtctcatcttaaaggaaacgttgtgttcataccctacattg |
5466706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 213 - 284
Target Start/End: Complemental strand, 42980783 - 42980712
Alignment:
| Q |
213 |
aagtttgttatagcgaaagctttactatgcaaggcagacatttcttcttttgacagacttcgacaacaggtt |
284 |
Q |
| |
|
|||||||| ||| | || |||||||||||||||||||||| |||||||||||| |||||| ||||||||| |
|
|
| T |
42980783 |
aagtttgtaataacaaaggctttactatgcaaggcagacagatcttcttttgaccgacttcatcaacaggtt |
42980712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University