View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19713_low_14 (Length: 342)
Name: NF19713_low_14
Description: NF19713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19713_low_14 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 333
Target Start/End: Original strand, 48085259 - 48085571
Alignment:
| Q |
1 |
ccatccatctgaaaaggcaaacaaaatcatagtcaaccaaatccttaggggcagtgctcagtacatgtatcccatgaatctcagcactatcatggcctta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48085259 |
ccatccatctgaaaaggcaaacaaaatcatagtcaaccgaatccttaggggcagtgctcagtacatgtatcccatgaatctcagcactatcatggcctta |
48085358 |
T |
|
| Q |
101 |
gattccaggacttgatcaatccatccaagacatttggttaatgnnnnnnngttagtttatgtgtgtattttctttatctgtgtccctttaatttatccat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
48085359 |
gattccaggacttgatcaatccatccaagacatttggttaatgtttttttgttagtttatgtgtgtattttctttatctgtgtc---------------- |
48085442 |
T |
|
| Q |
201 |
taatcttttgttttgtattccatagctagtggtttgtcatgccaagttcttgagtactggttttcccactcaaattgtcagtaataaaatgtcttccttt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48085443 |
----cttttgttttgtattccatagctagtggtttgtcatgccaagttcttgagtactggttttcccactcaaattgtcagtaataaaatgtcttccttt |
48085538 |
T |
|
| Q |
301 |
gattcaatcctagtgcaaacatttctttctgtg |
333 |
Q |
| |
|
| ||||||||||||||||||||||||||||||| |
|
|
| T |
48085539 |
gtttcaatcctagtgcaaacatttctttctgtg |
48085571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University