View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19713_low_19 (Length: 265)
Name: NF19713_low_19
Description: NF19713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19713_low_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 7 - 242
Target Start/End: Original strand, 10183221 - 10183448
Alignment:
| Q |
7 |
tccaagaatatacttctatccttttccttagcttttcaacttgtgccttaa-ggtagaaattaacattttcttaacttgcgatgtgtgttttaattgaat |
105 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |||||||| ||||| |||| |||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
10183221 |
tccaagaaaatacttctatccttttccttagcttttgaacttgtgtcttaaaggtacaaattaacatttccttaacttgcgatgtgtgttttaattgaat |
10183320 |
T |
 |
| Q |
106 |
ttgaagaatgcaggggctcttcagcaatttctcaatctaatgacccgtaaataaacgggttacaccgtatccataaaatccaaattttcattcaaaaaat |
205 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
10183321 |
ttgaagaatgcaggggctcttcag--------caaactaatgacccgtaaataaacgggttacaccgtatccat-aaatccaaattttcattcaaaaaat |
10183411 |
T |
 |
| Q |
206 |
tgaaacaaatccaaactcattttctttgtcagaatca |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10183412 |
tgaaacaaatccaaactcattttctttgtcagaatca |
10183448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University