View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19713_low_23 (Length: 253)
Name: NF19713_low_23
Description: NF19713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19713_low_23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 16 - 238
Target Start/End: Complemental strand, 5527492 - 5527274
Alignment:
| Q |
16 |
atactaaaagcaagcattggtgtccatggccctctttgaaagtcaatagcactattttaccaccaaagtttaaaaatattaaagatcaacaaaattactc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
5527492 |
atactaaaagcaagcattggtgtccatggccctctttgaaagtcaatagcactatttttccaccatagtttaaaaatattaaagatcaacaaaattactc |
5527393 |
T |
|
| Q |
116 |
aaactatatatataaggtaacatatttatgttcttatttctctatctctcttctttagggtgggtgactgatgtttggtccgaaccctttctttttgcta |
215 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
5527392 |
aaactatata----aggtaacatatttatgttcttatttctctatctctcttctttagggtgggtgactgatgtttggtcccaaccctttctttttgcta |
5527297 |
T |
|
| Q |
216 |
aagaaaaccacagtggtaatttg |
238 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
5527296 |
aagaaaaccacagtggtaatttg |
5527274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University