View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19713_low_29 (Length: 228)
Name: NF19713_low_29
Description: NF19713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19713_low_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 15050625 - 15050404
Alignment:
| Q |
1 |
tgtaactaatcccatttacgaaattcagagtcttgggctagtccactacagtgatacccacaaatttggcattttatagttcaaaatgatgattgtgtat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15050625 |
tgtaactaatcccatttacgaaattcagagtcttgggctagtccactacagtgatacccacaaatttggcattttatagttcaaaatgatgattgtgtat |
15050526 |
T |
 |
| Q |
101 |
gatgcaaacgcgac-gagggtgtgtcaaacaaaacagacaatttgtatttggtatgcatcataggaggatggattagagaactaaatcatgtgttgaaca |
199 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15050525 |
gatgcaaacgcgactgagggtgtgtcaaacaaaacagacaatttgtatttggtatgcatcataggaggatggattagagaactaaatcatgtgttgaaca |
15050426 |
T |
 |
| Q |
200 |
cccattagagttatctgtgctc |
221 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
15050425 |
cccattagagttatctgtgctc |
15050404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University