View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19713_low_30 (Length: 228)
Name: NF19713_low_30
Description: NF19713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19713_low_30 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 5e-83; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 46 - 209
Target Start/End: Original strand, 30885518 - 30885681
Alignment:
| Q |
46 |
gggctcaatacatgtgtgctcttttactgtcatggtgcagcatctattggctgctgctgatctctataatcttgacaggctaaaaatgttatgtgaatca |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30885518 |
gggctcaatacatgtgtgctcttttactgtcatggtgcagcatctattggctgctgctgatctctataatcttgacaggctaaaaatgttatgtgaatca |
30885617 |
T |
 |
| Q |
146 |
aaattgtgcgaagaaatcaatactgagaccgtagccacaacacttgccctggctgagcaacacc |
209 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
30885618 |
aaattgtgtgaagaaatcaatactgagaccgtagccacgacacttgccctggctgagcaacacc |
30885681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 16 - 47
Target Start/End: Original strand, 30885175 - 30885206
Alignment:
| Q |
16 |
atagggtgagttgtctctatcaaaataaacgg |
47 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
30885175 |
atagggtgagttgtctctatcaaaataaacgg |
30885206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University