View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19713_low_34 (Length: 214)
Name: NF19713_low_34
Description: NF19713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19713_low_34 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 20 - 199
Target Start/End: Complemental strand, 4170494 - 4170315
Alignment:
| Q |
20 |
cattattgggttgatattacagaatctggaattggttcgatcggtgggcttcgttgcaagtcgtttcgcgcaactttagctttgtaccgttaattttccg |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| | |||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4170494 |
cattattgggttgatattacagaatctggaattggttcgtttggtgggcttcattgcaagtcgtttcgcgcaacttcagctttgtaccgttaattttccg |
4170395 |
T |
|
| Q |
120 |
ggttgttgcttcattgttccactgttatgtgttaactggtgttcgatgctgtttctttgaaagtgtgtatacaatctgtg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4170394 |
ggttgttgcttcattgttccactgttatgtgttaactgatgttcgatgctgtttctttgaaagtgtgtatacaatctgtg |
4170315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University