View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19713_low_35 (Length: 202)
Name: NF19713_low_35
Description: NF19713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19713_low_35 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 12 - 184
Target Start/End: Original strand, 14943992 - 14944164
Alignment:
| Q |
12 |
tgagatgaaggatcttattcgatgatgcacaaataaccaatttgtaggtattggtatgaattgatgaatcaagcaattatccgtagagagtgatgctgct |
111 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
14943992 |
tgagatgaatgatcttattcgatgatgcacaaataaccaatttttaggtattggtatgaattgatgaatcaagcaattatgcgtagagagtgacgctgct |
14944091 |
T |
 |
| Q |
112 |
aaagcataattttattttgagagaatgttggttagtgttttgttgtatcaaagtattattgtaagtctatgtg |
184 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14944092 |
aaagcataattttattttgagagaatgttggttagtgttttgttgtatcaaagtattattgtaagtctatgtg |
14944164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University