View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19713_low_7 (Length: 455)
Name: NF19713_low_7
Description: NF19713
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19713_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 145; Significance: 4e-76; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 145; E-Value: 4e-76
Query Start/End: Original strand, 1 - 177
Target Start/End: Original strand, 8922770 - 8922947
Alignment:
| Q |
1 |
attaagaaattaacaattataaaaccatattatgaaattttaaataattttacgacgttttagtttttggcaatatattatcttttaaaagcatctccaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8922770 |
attaagaaattaacaattataaaaccatattacgaaattttaaataattttacgacgttttagtttttggcaatatattatcttttaaaagcatctccaa |
8922869 |
T |
|
| Q |
101 |
tgctcacttttttaacaaaataacgtttgcatgtttaga-nnnnnnnggtggtgctttgcatgtttagattgagaaca |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
8922870 |
tgctcacttttttaacaaaataacgtttgcatgtttagattttttttggtggtgctttgcatgtttagattgagaaca |
8922947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 118; E-Value: 5e-60
Query Start/End: Original strand, 334 - 455
Target Start/End: Original strand, 8922975 - 8923096
Alignment:
| Q |
334 |
acgtggaaaacattttccgagatctctcaatgcatgtcttgtacacttgattacgagttgagacacttaattagttgatatattgattattgcaccatag |
433 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8922975 |
acgtggaaaacattttccgagatctctcaatgcatgtcttgtacacttgattacgagttgagacacttaattagttgatatattgattattgcaccatag |
8923074 |
T |
|
| Q |
434 |
acgggtgaaatggagtaagcat |
455 |
Q |
| |
|
||||||||||||| |||||||| |
|
|
| T |
8923075 |
acgggtgaaatggcgtaagcat |
8923096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University