View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19714_high_8 (Length: 229)
Name: NF19714_high_8
Description: NF19714
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19714_high_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 72 - 210
Target Start/End: Complemental strand, 39128107 - 39127969
Alignment:
| Q |
72 |
gaaatgttgttcttacttacagttacaaaatatgatgatgatgaaaaagaaatgtaacagaaaggggaaggtgaaaaggaaagaagttggttctgctgag |
171 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39128107 |
gaaatgttgttcttacttacagttagaaaatatgatgatgatgaaaaagaaatgtaacagaaaggggaaggtgaaaaggaaagaagttggttctgctgag |
39128008 |
T |
 |
| Q |
172 |
aagaaatggcgtagcagtggcagcgtgggaggaaggaag |
210 |
Q |
| |
|
|||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
39128007 |
aagaaatggcttagtagtggcagcgtgggaggaaggaag |
39127969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University