View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19715_low_10 (Length: 223)

Name: NF19715_low_10
Description: NF19715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19715_low_10
NF19715_low_10
[»] chr1 (1 HSPs)
chr1 (20-204)||(9847419-9847603)


Alignment Details
Target: chr1 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 20 - 204
Target Start/End: Original strand, 9847419 - 9847603
Alignment:
20 taagaaacaacaaattgactaattttagaaattgttgaacaagtctatagattggggaggaggcgaaacaaaatttgaaggatttggcatgatgaaacta 119  Q
    ||||||||||||||||| || ||||||||||||||||||||||||||||||| |||||||||||||||||  || |||||||||||||||||||||||||    
9847419 taagaaacaacaaattgtctgattttagaaattgttgaacaagtctatagatgggggaggaggcgaaacaccatatgaaggatttggcatgatgaaacta 9847518  T
120 tttttcataaaatttctatcacttgaaagaactggactcaaatcattaatgaacttaatcatgtcgggatccaaaaacaatgacg 204  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||    
9847519 tttttcataaaatttctatcacttgaaagaactggactcaagtcattaatgaacttaatgatgtcgggatccaaaaacaatgacg 9847603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University