View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19715_low_3 (Length: 471)
Name: NF19715_low_3
Description: NF19715
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19715_low_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 285; Significance: 1e-159; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 285; E-Value: 1e-159
Query Start/End: Original strand, 1 - 293
Target Start/End: Original strand, 663664 - 663956
Alignment:
| Q |
1 |
cattgggtccaatgtcacctaatttggctctacttggttgttctaaaatgcttgttactgttgctggtaaggatcgttttagggacagagctgttttgta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
663664 |
cattgggtccaatgtcacctaatttggctttacttggttgttctaaaatgcttgttactgttgctggtaaggatcgttttagggacagagctgttttgta |
663763 |
T |
 |
| Q |
101 |
ttatgaagctgtgaaagggagtcattggaatggggaagttgaattttttgaagaagaagatgaagatcattgttattatatggtccatcctgaatctgat |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
663764 |
ttatgaagctgtgaaaaggagtcattggaatggggaagttgaattttttgaagaagaagatgaagatcattgttattatatggtccatcctgaatctgat |
663863 |
T |
 |
| Q |
201 |
aagggcaaaaaactcatcaaagttgtggctgattttcttcaccagtgaaagatttaagaaattgtatgggttgaataaggatatgtcatgcta |
293 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
663864 |
aagggcaaaaaactcatcaaagttgtggctgattttcttcaccagtgaaagatttaagaaattgtatgggttgaataaggatatgtcatgcta |
663956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 382 - 458
Target Start/End: Original strand, 664055 - 664131
Alignment:
| Q |
382 |
cacacatatagcaccttttactatgttgtttatgtcttacgtgtccttctactatgtcgtttttgtcttgcgtgtct |
458 |
Q |
| |
|
|||||||||||||||||||| ||||||| || |||||||||||| || ||||||||||||||| |||||||||||| |
|
|
| T |
664055 |
cacacatatagcaccttttatcatgttgtctacgtcttacgtgtcattttactatgtcgtttttatcttgcgtgtct |
664131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 141 - 199
Target Start/End: Original strand, 47301902 - 47301960
Alignment:
| Q |
141 |
gaattttttgaagaagaagatgaagatcattgttattatatggtccatcctgaatctga |
199 |
Q |
| |
|
||||| |||||||||||||||||||||||| |||| |||| | |||||||||||||| |
|
|
| T |
47301902 |
gaattgtttgaagaagaagatgaagatcatgtttatcatatctttcatcctgaatctga |
47301960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University