View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19717_high_17 (Length: 302)
Name: NF19717_high_17
Description: NF19717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19717_high_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 19 - 286
Target Start/End: Complemental strand, 37734012 - 37733745
Alignment:
| Q |
19 |
gaaagcgcgttaccgagcctagcaccggaggctttccacggtgtcggagattgacaagcgtgacagaggagagttctcatgtgtctctcaaccaaaaagt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37734012 |
gaaagcgcgttaccgagcctagcaccggaggctttccacggcgtgggagattgacaagcgtgacagaggagagttctcatgtgtctctcaaccaaaaagt |
37733913 |
T |
 |
| Q |
119 |
tagcagcgtggaccttagaatcgcagtcccagcataagctagcctggtctgactcacagaaagttctagctggaagcttgcagagttcgcagtttttctt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37733912 |
tagcagcgtggaccttagaatcgcagtcccagcataagctagcctggtctgactcacagaaagttctagctggaagcttgcagagttcgcagtttttctt |
37733813 |
T |
 |
| Q |
219 |
catgatcagagtcttctgattttcctttctctcaacgcggtttcgttcttcgttgatttgtgaatatt |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
37733812 |
catgatcagagtcttctgattttcctttctctcaacgcggtttcgttcttctttgatttgtgaatatt |
37733745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University