View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19717_high_23 (Length: 271)
Name: NF19717_high_23
Description: NF19717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19717_high_23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 1 - 252
Target Start/End: Original strand, 48156408 - 48156659
Alignment:
| Q |
1 |
gtccagtatctccatttcttctttagataaccctcttaagaaattttcctcatcttcttgaaacactttaaacccttctgccagcctttgtaacaaggtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48156408 |
gtccagtatctccatttcttctttagataaccctcttaagaaattttcctcatcttcttgaaacactttaaacccttctgccagcctttgtaacaaggtc |
48156507 |
T |
|
| Q |
101 |
atttctgttttgccaaccttctccaaatccttctccacctcctcttctaactcttcaacttccctcacaatggttttctctccttcctcaacctttttct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48156508 |
atttctgttttgccaaccttctccaaatccttctccacctcctcttctaactcttcaacttccctcacaatggttttctctccttcctcaacctttttct |
48156607 |
T |
|
| Q |
201 |
ccagcctttccacaatggaaggctctggtccacatgtgttatctgttctgat |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48156608 |
ccagcctttccacaatggaaggctctggtccacatgtgttatctgttctgat |
48156659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University