View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19717_high_35 (Length: 203)
Name: NF19717_high_35
Description: NF19717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19717_high_35 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 39 - 185
Target Start/End: Complemental strand, 4774508 - 4774362
Alignment:
| Q |
39 |
acaactggatctttttccacttctatttatttagaaaggaaagcaaagtaaattcacgagcaccatcataaacaatttacttgtataaatgtcaaattat |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4774508 |
acaactggatctttttccacttctatttatttagaaaggaaagcaaagtaaattcacgagcaccatcataaacaatttacttgtataaatgtcaaattat |
4774409 |
T |
|
| Q |
139 |
tctattattttcttccaaataaaaaattgatataattcttcgtaagt |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4774408 |
tctattattttcttccaaataaaaaattgatataattcttcgtaagt |
4774362 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University