View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19717_low_18 (Length: 308)
Name: NF19717_low_18
Description: NF19717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19717_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 15 - 207
Target Start/End: Complemental strand, 51928425 - 51928234
Alignment:
| Q |
15 |
caaaggcatgattattatcaactagaatcgaaaaggaagaataatatcatgaaaattgaagattcaaccacggtgaagaatgagggggcaaaaggaataa |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
51928425 |
caaaggcatgattattatcaactagaatcgaaaaggaagaataatatcttgaaaattgaagattcaaccacggtgaagaatgagggg-caaaaggaataa |
51928327 |
T |
 |
| Q |
115 |
caagacaaacctgcaatgcgatacggggacgaggctggttgatagatagaatagatgagtgaaaatcggcagccttgtgtaataaaattggac |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51928326 |
aaagacaaacctgcaatgcgatacggggacgaggctggttgatagatagaatagatgagtgaaaatcggcagccttgtgtaataaaattggac |
51928234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 246 - 290
Target Start/End: Complemental strand, 51928176 - 51928132
Alignment:
| Q |
246 |
gtacagttacatacgtcaaccttttctttctgtctttcttctaac |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
51928176 |
gtacagttacatacgtcaaccttttctttctgtctttcttataac |
51928132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University