View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19717_low_22 (Length: 292)
Name: NF19717_low_22
Description: NF19717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19717_low_22 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 24 - 282
Target Start/End: Original strand, 34308979 - 34309237
Alignment:
| Q |
24 |
gcttgatgtgcagaactaattaagattgcatgatacaactaggaaaattacatatctttaaattcatcatttaacttagaattgactcccaaatattttt |
123 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34308979 |
gcttgatgtgcagaactaattaagatggcatgatacaactaggaaaattacatatctttaaattcatcatttaacttagaattgactcccaaattttttt |
34309078 |
T |
|
| Q |
124 |
tcctgttacataattcatcaacatatttgagtaaaaaataaaacaatctgatgatgaatgtctctgtacattgttaacatacatctaggcactgccgtac |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34309079 |
tcctgttacataattcatcaacatatttgagtaaaaaataaaataatctgatgatgaatgtctctgtacattgttaacatacatctaggcactgccgtac |
34309178 |
T |
|
| Q |
224 |
taaaacaagatggcttgttcttaatttatctcgacctggacgaggttttttctcctttg |
282 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
34309179 |
taaaacaagatggcttgttctcaatttgtctcgacctggacgaggttttttctcttttg |
34309237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University