View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19717_low_25 (Length: 273)
Name: NF19717_low_25
Description: NF19717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19717_low_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 10 - 257
Target Start/End: Original strand, 44726388 - 44726635
Alignment:
| Q |
10 |
attattctaagttatagttttgtaaatttgtttgaaccagaacctaaatatggtaaatctaaggaaactttcaaagaatataaagttgttatgggattaa |
109 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44726388 |
attattctaagttatggttttgtaaatttgtttgtaccagaacctaaatatggtaaatctaaggaaactttcaaagaatataaagttgttatgggattaa |
44726487 |
T |
 |
| Q |
110 |
atttcattaactatttatctaatgccatcctcttggtcaattatatattttcactgttttaattaaatcttcacttgtcgtccatcatatgtttcatgat |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
44726488 |
atttcattaactatttatctaatgccatcctcttggtcaattatatattttcactgttttaattaaatcttcacttgtcgtccatcatatgtttccgtat |
44726587 |
T |
 |
| Q |
210 |
ctgaaaaacaatgagagatctattgtacttattcgcttatgatgtctc |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44726588 |
ctgaaaaacaatgagagatctattgtacttattcgcttatgatgtctc |
44726635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University