View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19717_low_28 (Length: 251)
Name: NF19717_low_28
Description: NF19717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19717_low_28 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 78; Significance: 2e-36; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 12 - 89
Target Start/End: Original strand, 952329 - 952406
Alignment:
| Q |
12 |
atgaattaatggaagaaagagatgaaatgaaacttacagtattcaagtttttccttgcagtctctctactgagtatat |
89 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
952329 |
atgaattaatggaagaaagagatgaaatgaaacttacagtattcaagtttttccttgcagtctctctactgagtatat |
952406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 12 - 89
Target Start/End: Complemental strand, 1099609 - 1099532
Alignment:
| Q |
12 |
atgaattaatggaagaaagagatgaaatgaaacttacagtattcaagtttttccttgcagtctctctactgagtatat |
89 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1099609 |
atgaattaatggaagaaagagatgaaatgaaacttacagtattcaagtttttccttgcagtctctctactgagtatat |
1099532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 113 - 174
Target Start/End: Original strand, 1091066 - 1091130
Alignment:
| Q |
113 |
gactaattaccttagtggttgttacaaga---gaggtgccactgctggtgaagttcgttgagagt |
174 |
Q |
| |
|
|||||||||||||||| |||||||||||| |||||||| |||| ||||||||| ||| ||||| |
|
|
| T |
1091066 |
gactaattaccttagtagttgttacaagagaggaggtgccgctgccggtgaagtttgttaagagt |
1091130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University