View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19717_low_29 (Length: 251)
Name: NF19717_low_29
Description: NF19717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19717_low_29 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 9e-85; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 9e-85
Query Start/End: Original strand, 11 - 232
Target Start/End: Complemental strand, 35041173 - 35040955
Alignment:
| Q |
11 |
tagcataggtggaatgatgtattgatgttcactcttgctttcttgtttcaatcaagaacgaacgcaagtcgctgtaatccatacgacggtcacggnnnnn |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35041173 |
tagcataggtggaatgatgtattgatgttcactcttgctt-cttgtttcaatcaagaacgaacacaagtcgctgtaatccatacgacggtcacggaaaaa |
35041075 |
T |
|
| Q |
111 |
nnncgttgtttttagatgatgaaagaaaggttctttaaaaactcaacaaactttgcaggagtaaaaaatattaatacaaacaatatcatctaatagagga |
210 |
Q |
| |
|
| | ||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
35041074 |
aaacatcgtttttagatgattaaagaaaggttctttaaaaactcaacaaactttgcaggagt--aaaatattaatacaaacaatataatctaatagagga |
35040977 |
T |
|
| Q |
211 |
tgtatttcagcattgtcacctg |
232 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
35040976 |
tgtatttcagcattgtcacctg |
35040955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 11 - 81
Target Start/End: Complemental strand, 35018953 - 35018886
Alignment:
| Q |
11 |
tagcataggtggaatgatgtattgatgttcactcttgctttcttgtttcaatcaagaacgaacgcaagtcg |
81 |
Q |
| |
|
||||||| |||||||||| | |||||||| |||||||||| | |||||||||||||||||||| ||||||| |
|
|
| T |
35018953 |
tagcataagtggaatgatat-ttgatgtt-actcttgctt-catgtttcaatcaagaacgaacacaagtcg |
35018886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University