View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19717_low_40 (Length: 202)

Name: NF19717_low_40
Description: NF19717
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19717_low_40
NF19717_low_40
[»] chr2 (1 HSPs)
chr2 (1-151)||(37733616-37733768)


Alignment Details
Target: chr2 (Bit Score: 130; Significance: 1e-67; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 1 - 151
Target Start/End: Complemental strand, 37733768 - 37733616
Alignment:
1 gttcttcgttgatttgtgaatattgtttttgcggaattttcgttgttttgggt--ctctctctcttttcttgtgatggtttggtatggatgaagaatggg 98  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||| |||  |||||||||||||||||||||||||||||||||||||||||||||    
37733768 gttcttctttgatttgtgaatattgtttttgcggaattttcgttgtttttggtttctctctctcttttcttgtgatggtttggtatggatgaagaatggg 37733669  T
99 taagaagaggaaagtagatacctcttcctgatatttataagcaaaaagtatat 151  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||||    
37733668 taagaagaggaaagtagatgcctcttcctgatatttataagcaaaaagtatat 37733616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University