View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19718_high_30 (Length: 227)
Name: NF19718_high_30
Description: NF19718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19718_high_30 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 6 - 227
Target Start/End: Original strand, 40340427 - 40340648
Alignment:
| Q |
6 |
aatatacttgtagttttt--tattctttttcttt-ctgaaattgtgatcacatcacatggcaatgaaaacgtgggcaaacaatccagagaaataacacaa |
102 |
Q |
| |
|
|||||||||||||||||| | || ||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
40340427 |
aatatacttgtagtttttgtttttttttttcttttctgaaattgtgatcacatcacatggcaatcaaaacgtgggcaaacaatccagagaaataacacaa |
40340526 |
T |
 |
| Q |
103 |
taattaaacnnnnnnnnnnnnnnnn-cgagtactaaaaaatgttaccatttactcaaaattgatccttagtcggtcggtagcaatagctccatgaaagtg |
201 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
40340527 |
taattaaactttttatattttattttcgagtactaaaaaatgttaccatttactcaaaattgatcctta----gtcggtagcaatagctacatgaaagtg |
40340622 |
T |
 |
| Q |
202 |
aaaaatatctaatatttatatcgata |
227 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
40340623 |
aaaaatatctaatatttatatcgata |
40340648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University