View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19718_low_27 (Length: 249)
Name: NF19718_low_27
Description: NF19718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19718_low_27 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 1 - 136
Target Start/End: Complemental strand, 27600280 - 27600144
Alignment:
| Q |
1 |
taaaaattaattaatttttaaattcagaaagtcaatgtgttacccctcaattcactttatttccacgagatgtcacctcatggtaaaagtttagcatagt |
100 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27600280 |
taaaaactaattaatttttaaattcagaaagtcaatgtgttacacctcaattcactttatttccacgagatgtcacctcatggtaaaagtttagcatagt |
27600181 |
T |
|
| Q |
101 |
aacttaaaagaacaagttt-aatcttacatgagactg |
136 |
Q |
| |
|
||| ||||||||||||||| ||||||| ||||||||| |
|
|
| T |
27600180 |
aacctaaaagaacaagtttaaatcttatatgagactg |
27600144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 129 - 175
Target Start/End: Complemental strand, 27599209 - 27599163
Alignment:
| Q |
129 |
tgagactgatgtaaaactatagttggttccatcactatcaataataa |
175 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
27599209 |
tgagactgatgtaaaactatccttgcttccatcactatcaataataa |
27599163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University