View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19719_high_6 (Length: 319)
Name: NF19719_high_6
Description: NF19719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19719_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 11 - 301
Target Start/End: Complemental strand, 27733609 - 27733317
Alignment:
| Q |
11 |
taattctttagaaacgggaaaaggtttagatgaaagatcggatgctgcaaatgatattgaggttctgttaacaggtcaaacaatttcttctttcttattg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
27733609 |
taattctttagaaacgggaaaaggtttagatgaaagatcggatgctgcaaatgatattgaggttctattaacaggtcaaacaatttcttctttcttattg |
27733510 |
T |
 |
| Q |
111 |
c--tattattctgcattactcacaatcatgactgatgaccaactttaatacaatttaaaggtcagaatgagaaggttgacggctcggatgatggtaccac |
208 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
27733509 |
cactattattctgcattactcacaatcatgactgatgaccaactttaatacaatttaaaggtcagaatgagaaggttgacggctcagatgatggtaccac |
27733410 |
T |
 |
| Q |
209 |
ggtattaactgaatttcttcagggggacagttctggtagtatgtatgctgactcaactccgagtttagatgaatgcacttccgcccctgtaga |
301 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27733409 |
ggtatcaactgaatttcttcagggggacagttctggtagtatgtatgctgactcaactccgagtttagatgaatgcacttccgcccctgtaga |
27733317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University