View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19719_low_8 (Length: 333)

Name: NF19719_low_8
Description: NF19719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19719_low_8
NF19719_low_8
[»] chr8 (3 HSPs)
chr8 (224-263)||(32070608-32070647)
chr8 (166-216)||(32067708-32067758)
chr8 (82-145)||(32070921-32070983)


Alignment Details
Target: chr8 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 224 - 263
Target Start/End: Complemental strand, 32070647 - 32070608
Alignment:
224 attactttaatcattttatgatttgctgctattgcatggg 263  Q
    ||||||||||||||||||||||||||||||||||||||||    
32070647 attactttaatcattttatgatttgctgctattgcatggg 32070608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 166 - 216
Target Start/End: Complemental strand, 32067758 - 32067708
Alignment:
166 tcacacttcacgtggccaatttaaattttcacaaatctttgaaaatggttt 216  Q
    ||||| |||||||||||||||||||||||| |||||| |||||||||||||    
32067758 tcacatttcacgtggccaatttaaattttcgcaaatcattgaaaatggttt 32067708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 82 - 145
Target Start/End: Complemental strand, 32070983 - 32070921
Alignment:
82 aatactaaaattattagaagggatcccggaagaaattttgtagactttgaaatcttttttgtca 145  Q
    |||||||||||||||||||||||| ||  ||| | || |||||||||||||| |||||||||||    
32070983 aatactaaaattattagaagggattcctcaag-atttgtgtagactttgaaaacttttttgtca 32070921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University