View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1971_high_2 (Length: 425)

Name: NF1971_high_2
Description: NF1971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1971_high_2
NF1971_high_2
[»] chr4 (71 HSPs)
chr4 (1-409)||(21429305-21429709)
chr4 (10-109)||(16450313-16450412)
chr4 (1-108)||(40780861-40780968)
chr4 (19-109)||(38166049-38166139)
chr4 (8-109)||(2559318-2559419)
chr4 (10-103)||(3159474-3159567)
chr4 (10-109)||(20128322-20128421)
chr4 (10-109)||(38075446-38075545)
chr4 (23-109)||(7246645-7246731)
chr4 (22-103)||(49260670-49260751)
chr4 (13-109)||(5472847-5472943)
chr4 (1-109)||(30317237-30317345)
chr4 (1-109)||(52950086-52950194)
chr4 (10-109)||(4738631-4738730)
chr4 (10-109)||(16645131-16645230)
chr4 (10-109)||(29895800-29895899)
chr4 (8-109)||(43458624-43458725)
chr4 (1-109)||(10541020-10541127)
chr4 (23-99)||(36262776-36262852)
chr4 (20-103)||(8889045-8889128)
chr4 (38-109)||(14858751-14858822)
chr4 (10-109)||(47078471-47078570)
chr4 (10-109)||(55921047-55921146)
chr4 (1-99)||(40272340-40272438)
chr4 (19-109)||(42722576-42722666)
chr4 (3-108)||(14859297-14859402)
chr4 (10-99)||(20421786-20421875)
chr4 (1-103)||(1940782-1940881)
chr4 (1-109)||(17946494-17946601)
chr4 (24-103)||(295538-295617)
chr4 (19-109)||(3574447-3574535)
chr4 (10-97)||(20532420-20532507)
chr4 (26-109)||(24166479-24166562)
chr4 (10-97)||(29588749-29588836)
chr4 (19-109)||(18531541-18531631)
chr4 (10-108)||(33647734-33647832)
chr4 (1-109)||(14124020-14124128)
chr4 (23-98)||(3507296-3507371)
chr4 (22-109)||(17080068-17080155)
chr4 (22-109)||(47682381-47682468)
chr4 (10-109)||(48015072-48015171)
chr4 (8-99)||(48317284-48317375)
chr4 (10-109)||(53599073-53599172)
chr4 (38-108)||(6032643-6032713)
chr4 (18-88)||(7741946-7742016)
chr4 (22-108)||(13073563-13073649)
chr4 (22-100)||(46108716-46108794)
chr4 (24-109)||(21192667-21192752)
chr4 (24-109)||(38168284-38168368)
chr4 (37-109)||(14567279-14567351)
chr4 (10-81)||(1446839-1446910)
chr4 (10-109)||(6779224-6779323)
chr4 (22-109)||(15732447-15732534)
chr4 (13-80)||(20354653-20354720)
chr4 (19-109)||(27248450-27248538)
chr4 (10-109)||(35359749-35359848)
chr4 (10-109)||(36145214-36145313)
chr4 (10-109)||(43468360-43468459)
chr4 (14-109)||(45721103-45721198)
chr4 (13-109)||(15829715-15829811)
chr4 (12-109)||(25406562-25406662)
chr4 (37-109)||(48834699-48834771)
chr4 (22-109)||(42722378-42722465)
chr4 (25-100)||(50485971-50486046)
chr4 (37-103)||(14597905-14597971)
chr4 (26-98)||(4736626-4736698)
chr4 (10-98)||(26237432-26237520)
chr4 (61-109)||(27531669-27531717)
chr4 (22-86)||(41339417-41339481)
chr4 (25-97)||(53354560-53354632)
chr4 (9-73)||(55005341-55005405)
[»] chr2 (66 HSPs)
chr2 (20-109)||(25540403-25540492)
chr2 (1-109)||(6358150-6358258)
chr2 (10-109)||(12455318-12455417)
chr2 (8-109)||(12864230-12864331)
chr2 (10-109)||(16325603-16325702)
chr2 (10-109)||(38962771-38962870)
chr2 (19-109)||(10823077-10823167)
chr2 (1-109)||(8410130-8410238)
chr2 (10-98)||(10026626-10026714)
chr2 (19-103)||(10669609-10669693)
chr2 (1-109)||(28616378-28616486)
chr2 (13-109)||(34346286-34346382)
chr2 (22-109)||(18902529-18902616)
chr2 (9-104)||(39201512-39201607)
chr2 (10-109)||(44139492-44139591)
chr2 (18-100)||(42770659-42770741)
chr2 (1-109)||(37560172-37560280)
chr2 (10-109)||(22593143-22593240)
chr2 (22-109)||(35946758-35946845)
chr2 (10-109)||(41031905-41032004)
chr2 (10-109)||(41220643-41220742)
chr2 (24-109)||(3643886-3643971)
chr2 (1-109)||(14169608-14169716)
chr2 (13-109)||(27725951-27726047)
chr2 (10-109)||(28525454-28525554)
chr2 (10-109)||(15234060-15234159)
chr2 (10-109)||(16034945-16035044)
chr2 (8-99)||(37804900-37804991)
chr2 (22-109)||(38005422-38005509)
chr2 (1-71)||(18846258-18846328)
chr2 (10-99)||(331509-331598)
chr2 (24-109)||(7747296-7747381)
chr2 (10-103)||(7787064-7787157)
chr2 (20-109)||(11069896-11069985)
chr2 (24-109)||(20116611-20116696)
chr2 (24-109)||(44945615-44945700)
chr2 (1-109)||(2550867-2550975)
chr2 (10-108)||(20612534-20612634)
chr2 (26-109)||(9360747-9360830)
chr2 (22-109)||(33005771-33005858)
chr2 (10-109)||(34722688-34722787)
chr2 (26-109)||(39806884-39806967)
chr2 (1-103)||(31740766-31740868)
chr2 (39-108)||(2784969-2785038)
chr2 (10-98)||(10046487-10046574)
chr2 (12-100)||(26805306-26805394)
chr2 (10-109)||(29422223-29422322)
chr2 (10-93)||(45263682-45263765)
chr2 (8-90)||(29653633-29653714)
chr2 (1-54)||(14853421-14853474)
chr2 (8-109)||(18649025-18649126)
chr2 (22-91)||(24179588-24179657)
chr2 (1-109)||(3811690-3811798)
chr2 (25-109)||(13104824-13104908)
chr2 (10-98)||(34356214-34356302)
chr2 (47-103)||(34738338-34738394)
chr2 (1-100)||(13026419-13026518)
chr2 (10-73)||(15079491-15079554)
chr2 (10-109)||(19976806-19976905)
chr2 (46-100)||(20963118-20963172)
chr2 (1-55)||(43303345-43303399)
chr2 (26-99)||(4080326-4080399)
chr2 (40-84)||(3042527-3042571)
chr2 (77-109)||(29299353-29299385)
chr2 (21-73)||(30721890-30721942)
chr2 (1-109)||(34130301-34130408)
[»] scaffold0170 (1 HSPs)
scaffold0170 (8-104)||(9854-9950)
[»] chr6 (39 HSPs)
chr6 (1-109)||(13036003-13036111)
chr6 (10-109)||(3601096-3601195)
chr6 (25-109)||(9633624-9633708)
chr6 (1-109)||(12606433-12606541)
chr6 (10-98)||(29444775-29444863)
chr6 (19-109)||(19089519-19089609)
chr6 (19-109)||(31129198-31129288)
chr6 (10-109)||(5253222-5253321)
chr6 (10-109)||(6606096-6606195)
chr6 (10-109)||(21898660-21898759)
chr6 (38-108)||(11142643-11142713)
chr6 (1-99)||(34954628-34954726)
chr6 (24-109)||(30788852-30788937)
chr6 (25-99)||(2271312-2271386)
chr6 (20-109)||(13468955-13469044)
chr6 (1-72)||(9366459-9366530)
chr6 (22-109)||(10311468-10311555)
chr6 (19-109)||(12635835-12635925)
chr6 (1-109)||(8932664-8932772)
chr6 (1-109)||(8944130-8944238)
chr6 (10-109)||(5029829-5029928)
chr6 (22-109)||(29333138-29333225)
chr6 (9-99)||(8888893-8888983)
chr6 (1-103)||(13391290-13391391)
chr6 (40-109)||(14783419-14783488)
chr6 (10-109)||(8938723-8938822)
chr6 (10-109)||(30410457-30410556)
chr6 (1-108)||(32157167-32157274)
chr6 (24-109)||(8611973-8612058)
chr6 (1-53)||(32048454-32048506)
chr6 (10-109)||(14107357-14107456)
chr6 (10-57)||(33859370-33859417)
chr6 (37-99)||(21872942-21873004)
chr6 (23-109)||(24671865-24671951)
chr6 (22-98)||(3587955-3588031)
chr6 (68-108)||(8149797-8149837)
chr6 (10-102)||(9179742-9179834)
chr6 (1-73)||(10396477-10396548)
chr6 (13-101)||(33940026-33940114)
[»] chr7 (55 HSPs)
chr7 (10-109)||(17748381-17748480)
chr7 (1-109)||(38578866-38578974)
chr7 (1-109)||(44961637-44961745)
chr7 (1-109)||(8734685-8734793)
chr7 (10-101)||(22973978-22974069)
chr7 (10-109)||(5069814-5069913)
chr7 (22-109)||(48804706-48804793)
chr7 (23-109)||(41945497-41945583)
chr7 (10-99)||(23658190-23658279)
chr7 (1-102)||(28396166-28396267)
chr7 (20-109)||(28744183-28744272)
chr7 (20-93)||(49142684-49142757)
chr7 (19-103)||(13095878-13095962)
chr7 (1-109)||(27028281-27028389)
chr7 (10-109)||(1605952-1606051)
chr7 (10-109)||(34659237-34659336)
chr7 (10-108)||(26423288-26423385)
chr7 (1-99)||(45697199-45697296)
chr7 (20-109)||(48551878-48551967)
chr7 (10-109)||(10047875-10047974)
chr7 (8-108)||(27875088-27875188)
chr7 (1-101)||(45447972-45448072)
chr7 (10-109)||(37514932-37515031)
chr7 (22-109)||(43346778-43346865)
chr7 (10-109)||(43861971-43862070)
chr7 (10-109)||(47341887-47341986)
chr7 (28-109)||(21190779-21190860)
chr7 (24-109)||(22993366-22993451)
chr7 (37-109)||(3353462-3353534)
chr7 (1-85)||(30827294-30827378)
chr7 (23-103)||(39420861-39420941)
chr7 (10-109)||(4705983-4706082)
chr7 (20-103)||(18785690-18785773)
chr7 (46-109)||(32768984-32769047)
chr7 (22-109)||(39474963-39475050)
chr7 (10-103)||(1797471-1797564)
chr7 (40-100)||(41267932-41267992)
chr7 (10-109)||(4195201-4195300)
chr7 (8-103)||(16802132-16802227)
chr7 (19-102)||(21530768-21530851)
chr7 (10-109)||(36619253-36619352)
chr7 (26-109)||(42210261-42210344)
chr7 (39-109)||(3603397-3603467)
chr7 (1-99)||(20247179-20247277)
chr7 (23-109)||(24969325-24969411)
chr7 (22-100)||(42032119-42032197)
chr7 (14-103)||(14535306-14535395)
chr7 (24-100)||(19914711-19914787)
chr7 (10-109)||(365151-365250)
chr7 (10-109)||(43925523-43925622)
chr7 (42-88)||(4973130-4973176)
chr7 (40-109)||(24983417-24983487)
chr7 (37-109)||(45758325-45758395)
chr7 (1-109)||(14650319-14650427)
chr7 (23-99)||(48224740-48224816)
[»] scaffold0316 (1 HSPs)
scaffold0316 (1-109)||(1613-1721)
[»] chr8 (42 HSPs)
chr8 (1-109)||(43032904-43033012)
chr8 (1-109)||(3418512-3418620)
chr8 (22-108)||(4479296-4479382)
chr8 (22-108)||(15884556-15884642)
chr8 (1-103)||(18374013-18374115)
chr8 (22-109)||(14846599-14846686)
chr8 (10-109)||(17981453-17981552)
chr8 (15-109)||(11298266-11298360)
chr8 (24-109)||(10927632-10927717)
chr8 (10-109)||(2467117-2467216)
chr8 (10-109)||(8141114-8141213)
chr8 (22-109)||(8997543-8997630)
chr8 (10-109)||(14666070-14666169)
chr8 (10-100)||(9860003-9860093)
chr8 (24-109)||(2964102-2964187)
chr8 (18-103)||(13357961-13358046)
chr8 (25-109)||(23895595-23895679)
chr8 (1-109)||(36662408-36662515)
chr8 (10-109)||(6100484-6100583)
chr8 (10-109)||(16291202-16291301)
chr8 (10-109)||(24837254-24837353)
chr8 (10-89)||(33401818-33401897)
chr8 (23-109)||(583837-583923)
chr8 (20-109)||(26570946-26571035)
chr8 (20-99)||(3567926-3568005)
chr8 (10-109)||(43027317-43027416)
chr8 (20-103)||(44893283-44893366)
chr8 (22-109)||(45521192-45521279)
chr8 (1-63)||(35496300-35496362)
chr8 (10-103)||(68103-68196)
chr8 (39-108)||(3379812-3379881)
chr8 (27-108)||(28738151-28738232)
chr8 (67-103)||(4772056-4772092)
chr8 (42-109)||(993232-993299)
chr8 (15-109)||(22212514-22212609)
chr8 (19-57)||(8586990-8587028)
chr8 (47-109)||(8817082-8817144)
chr8 (9-87)||(22958781-22958859)
chr8 (10-63)||(38922459-38922512)
chr8 (37-73)||(10698962-10698998)
chr8 (1-109)||(16893940-16894046)
chr8 (1-97)||(43349327-43349423)
[»] chr1 (68 HSPs)
chr1 (1-109)||(18649352-18649460)
chr1 (10-109)||(17642004-17642103)
chr1 (19-109)||(8764009-8764099)
chr1 (10-102)||(2567285-2567377)
chr1 (19-109)||(43959821-43959911)
chr1 (10-99)||(14254278-14254367)
chr1 (1-100)||(15465965-15466064)
chr1 (23-109)||(34719798-34719884)
chr1 (20-97)||(12036756-12036833)
chr1 (37-109)||(4581682-4581754)
chr1 (1-109)||(26325812-26325920)
chr1 (1-109)||(33004015-33004123)
chr1 (21-109)||(37339840-37339928)
chr1 (10-109)||(5855531-5855630)
chr1 (1-100)||(10336516-10336615)
chr1 (10-109)||(10422797-10422896)
chr1 (22-109)||(11397889-11397976)
chr1 (20-99)||(33418125-33418204)
chr1 (10-109)||(41663856-41663955)
chr1 (10-109)||(45361882-45361981)
chr1 (1-103)||(30927733-30927835)
chr1 (10-103)||(17092483-17092576)
chr1 (25-109)||(10172971-10173055)
chr1 (1-109)||(16263545-16263653)
chr1 (10-109)||(2980931-2981030)
chr1 (10-109)||(18915876-18915975)
chr1 (10-109)||(32142846-32142945)
chr1 (10-109)||(35211172-35211271)
chr1 (10-109)||(49078123-49078222)
chr1 (10-109)||(50371834-50371933)
chr1 (1-102)||(5504031-5504132)
chr1 (1-102)||(15238113-15238214)
chr1 (1-57)||(12744575-12744631)
chr1 (1-57)||(12755565-12755621)
chr1 (10-102)||(33498846-33498938)
chr1 (1-109)||(50503361-50503469)
chr1 (22-109)||(9659179-9659266)
chr1 (18-109)||(16956483-16956574)
chr1 (10-88)||(31152725-31152803)
chr1 (8-103)||(35908764-35908858)
chr1 (1-98)||(40226253-40226350)
chr1 (8-97)||(48761183-48761272)
chr1 (22-103)||(50094925-50095006)
chr1 (22-102)||(21849212-21849292)
chr1 (25-109)||(44969688-44969772)
chr1 (20-103)||(9853283-9853366)
chr1 (10-109)||(26660147-26660245)
chr1 (10-100)||(17358480-17358570)
chr1 (20-73)||(6563460-6563513)
chr1 (8-109)||(25165408-25165508)
chr1 (20-81)||(31734307-31734368)
chr1 (46-103)||(38859122-38859179)
chr1 (10-99)||(40288487-40288576)
chr1 (19-99)||(10507716-10507796)
chr1 (1-109)||(32150922-32151030)
chr1 (1-109)||(34697335-34697443)
chr1 (1-57)||(42710190-42710246)
chr1 (1-57)||(48798122-48798178)
chr1 (23-102)||(16150689-16150768)
chr1 (67-109)||(51437523-51437565)
chr1 (40-109)||(6899597-6899666)
chr1 (23-100)||(25178585-25178662)
chr1 (39-108)||(30044501-30044570)
chr1 (10-103)||(31576553-31576646)
chr1 (1-109)||(14357755-14357863)
chr1 (1-109)||(17389772-17389879)
chr1 (1-109)||(18808265-18808373)
chr1 (10-98)||(41696609-41696697)
[»] chr5 (72 HSPs)
chr5 (10-109)||(5731919-5732018)
chr5 (10-109)||(9805013-9805112)
chr5 (10-109)||(42086336-42086435)
chr5 (20-109)||(8513538-8513627)
chr5 (10-109)||(12081917-12082016)
chr5 (22-109)||(38897718-38897805)
chr5 (15-109)||(43399142-43399236)
chr5 (8-109)||(13664267-13664368)
chr5 (1-109)||(4016254-4016362)
chr5 (13-109)||(20682616-20682712)
chr5 (9-109)||(40117423-40117523)
chr5 (10-109)||(1538440-1538539)
chr5 (10-109)||(23383666-23383765)
chr5 (8-109)||(14728089-14728191)
chr5 (19-108)||(42291505-42291594)
chr5 (1-109)||(14588616-14588724)
chr5 (19-103)||(39099784-39099868)
chr5 (1-108)||(20525838-20525945)
chr5 (26-109)||(20692958-20693041)
chr5 (10-109)||(25417182-25417281)
chr5 (1-108)||(37263241-37263347)
chr5 (25-103)||(3653919-3653997)
chr5 (8-97)||(19839334-19839423)
chr5 (2-103)||(24463891-24463992)
chr5 (1-109)||(11845800-11845908)
chr5 (25-109)||(20255393-20255477)
chr5 (10-109)||(12766140-12766239)
chr5 (19-109)||(19572742-19572832)
chr5 (1-89)||(21149734-21149822)
chr5 (1-97)||(24875345-24875441)
chr5 (1-109)||(38369700-38369807)
chr5 (1-109)||(41800977-41801085)
chr5 (22-109)||(2485217-2485304)
chr5 (24-103)||(9168258-9168337)
chr5 (9-80)||(35638061-35638132)
chr5 (26-109)||(42861217-42861300)
chr5 (43-109)||(40773315-40773381)
chr5 (24-109)||(7866604-7866689)
chr5 (24-109)||(9812895-9812980)
chr5 (22-103)||(20590020-20590101)
chr5 (13-109)||(5079343-5079438)
chr5 (1-109)||(23247351-23247458)
chr5 (7-63)||(25467416-25467472)
chr5 (14-109)||(18262617-18262712)
chr5 (22-109)||(41163459-41163546)
chr5 (26-100)||(15034100-15034174)
chr5 (39-97)||(24499020-24499078)
chr5 (1-103)||(28862825-28862927)
chr5 (12-98)||(32874798-32874884)
chr5 (24-109)||(12705037-12705122)
chr5 (10-71)||(26077150-26077211)
chr5 (1-89)||(14974343-14974431)
chr5 (1-57)||(20705563-20705619)
chr5 (10-108)||(21487626-21487721)
chr5 (45-109)||(27648424-27648488)
chr5 (1-73)||(30995121-30995193)
chr5 (22-109)||(7616941-7617028)
chr5 (26-109)||(20228742-20228825)
chr5 (38-109)||(21375388-21375459)
chr5 (10-109)||(24653811-24653909)
chr5 (10-57)||(28857137-28857184)
chr5 (10-49)||(40060305-40060344)
chr5 (11-49)||(20516460-20516498)
chr5 (39-109)||(22655157-22655226)
chr5 (23-73)||(35006770-35006820)
chr5 (1-103)||(39728387-39728489)
chr5 (40-109)||(6764456-6764525)
chr5 (1-102)||(7308370-7308471)
chr5 (10-50)||(1899010-1899050)
chr5 (25-89)||(7336644-7336708)
chr5 (49-109)||(28857194-28857254)
chr5 (10-62)||(35403558-35403610)
[»] chr3 (69 HSPs)
chr3 (8-109)||(3136694-3136794)
chr3 (4-109)||(19146963-19147068)
chr3 (1-98)||(30767258-30767355)
chr3 (1-109)||(31072877-31072985)
chr3 (10-109)||(28572211-28572310)
chr3 (20-103)||(50405609-50405692)
chr3 (1-103)||(10040556-10040657)
chr3 (20-98)||(30045839-30045917)
chr3 (23-108)||(3507534-3507619)
chr3 (24-109)||(54261248-54261333)
chr3 (1-109)||(928599-928707)
chr3 (1-109)||(29127918-29128026)
chr3 (1-109)||(47219143-47219251)
chr3 (1-109)||(51060281-51060389)
chr3 (10-109)||(7650235-7650334)
chr3 (22-97)||(8164573-8164648)
chr3 (8-102)||(29135919-29136013)
chr3 (10-103)||(24506654-24506746)
chr3 (12-109)||(29762155-29762252)
chr3 (20-109)||(48342038-48342127)
chr3 (13-73)||(11687145-11687205)
chr3 (13-109)||(13893937-13894033)
chr3 (1-109)||(35315955-35316063)
chr3 (10-109)||(7328852-7328950)
chr3 (10-109)||(15320194-15320293)
chr3 (10-109)||(45877462-45877561)
chr3 (22-109)||(47749105-47749192)
chr3 (38-109)||(49021203-49021274)
chr3 (11-109)||(54237457-54237555)
chr3 (25-109)||(15084945-15085029)
chr3 (1-109)||(23511566-23511674)
chr3 (21-109)||(25294979-25295067)
chr3 (1-109)||(26361967-26362075)
chr3 (20-100)||(49198369-49198449)
chr3 (23-103)||(55069685-55069765)
chr3 (20-103)||(35923629-35923712)
chr3 (22-109)||(41630512-41630599)
chr3 (22-109)||(47471851-47471938)
chr3 (1-108)||(51682955-51683062)
chr3 (15-93)||(7648753-7648831)
chr3 (10-108)||(53649735-53649833)
chr3 (22-103)||(33688971-33689052)
chr3 (1-98)||(49543518-49543615)
chr3 (38-102)||(43330739-43330803)
chr3 (10-101)||(26043820-26043911)
chr3 (20-87)||(32873571-32873638)
chr3 (18-109)||(34374442-34374533)
chr3 (26-109)||(35998571-35998654)
chr3 (22-109)||(45450447-45450534)
chr3 (10-73)||(49082832-49082895)
chr3 (26-100)||(4638178-4638252)
chr3 (10-108)||(6462420-6462518)
chr3 (35-109)||(10043715-10043789)
chr3 (45-103)||(50753347-50753405)
chr3 (26-103)||(8362601-8362678)
chr3 (13-62)||(10855395-10855444)
chr3 (22-103)||(15795500-15795581)
chr3 (1-109)||(26923261-26923369)
chr3 (53-109)||(36043674-36043730)
chr3 (24-96)||(52364813-52364885)
chr3 (10-109)||(7310703-7310802)
chr3 (8-99)||(22405553-22405644)
chr3 (10-109)||(26590266-26590365)
chr3 (23-98)||(33251683-33251758)
chr3 (23-98)||(45402362-45402437)
chr3 (61-99)||(32522038-32522076)
chr3 (22-103)||(26207807-26207888)
chr3 (42-103)||(44064584-44064645)
chr3 (67-99)||(8683250-8683282)
[»] scaffold0010 (2 HSPs)
scaffold0010 (10-109)||(155710-155809)
scaffold0010 (20-108)||(25784-25872)
[»] scaffold0291 (1 HSPs)
scaffold0291 (10-109)||(6866-6965)
[»] scaffold0016 (1 HSPs)
scaffold0016 (10-109)||(8700-8799)
[»] scaffold0024 (1 HSPs)
scaffold0024 (10-103)||(149396-149489)
[»] scaffold0086 (1 HSPs)
scaffold0086 (10-109)||(26194-26293)
[»] scaffold0002 (2 HSPs)
scaffold0002 (10-109)||(581-680)
scaffold0002 (20-109)||(319443-319532)
[»] scaffold0006 (1 HSPs)
scaffold0006 (1-103)||(68519-68618)
[»] scaffold0384 (1 HSPs)
scaffold0384 (10-100)||(5984-6073)
[»] scaffold0376 (1 HSPs)
scaffold0376 (24-109)||(12695-12780)
[»] scaffold0029 (1 HSPs)
scaffold0029 (1-102)||(41046-41147)
[»] scaffold0009 (2 HSPs)
scaffold0009 (20-109)||(42831-42920)
scaffold0009 (68-108)||(9511-9551)
[»] scaffold0223 (1 HSPs)
scaffold0223 (18-109)||(16898-16989)
[»] scaffold0209 (1 HSPs)
scaffold0209 (23-109)||(12597-12683)
[»] scaffold0011 (2 HSPs)
scaffold0011 (39-109)||(224357-224427)
scaffold0011 (39-108)||(186557-186626)
[»] scaffold0041 (1 HSPs)
scaffold0041 (13-109)||(25100-25195)
[»] scaffold0005 (3 HSPs)
scaffold0005 (37-109)||(250024-250096)
scaffold0005 (37-103)||(219407-219473)
scaffold0005 (1-63)||(271119-271181)
[»] scaffold0341 (1 HSPs)
scaffold0341 (20-73)||(18653-18706)
[»] scaffold0116 (1 HSPs)
scaffold0116 (3-100)||(17394-17491)
[»] scaffold0079 (1 HSPs)
scaffold0079 (23-109)||(8198-8273)
[»] scaffold0004 (1 HSPs)
scaffold0004 (22-102)||(7841-7921)


Alignment Details
Target: chr4 (Bit Score: 287; Significance: 1e-161; HSPs: 71)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 287; E-Value: 1e-161
Query Start/End: Original strand, 1 - 409
Target Start/End: Original strand, 21429305 - 21429709
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||| | ||||||||| ||||||||||||| |||||||||||||||||||||||| |||||||||| |||| ||||||||||||||||||||||||||    
21429305 aatatcgggttcgatttttagggggaacaacgtttagccagtgcgcatgcctctacgcacgagtcagactagtcgtccacctttggtgggtcggaaaccg 21429404  T
101 gtgagaaagnnnnnnnntactataatacatctgtttcaaaatatataattttgttgatcaaatcacggaaatttagaagagaatgccttaatatagtcgt 200  Q
    ||| ||| |         | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21429405 gtgcgaatgaaaaaa---aatataatacatctgtttcaaaatatataattttgttgatcaaatcacggaaatttagaagagaatgccttaatatagtcgt 21429501  T
201 attaagataaaccgtatatttccattttagtaatatatgctgatttcttgtnnnnnnnnnngagtaatatatgttgatttggtattataatatatataat 300  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||           |||||||||||||||||||||||||||||||| |||||    
21429502 attaagataaaccgtatatttccattttagttatatatgctgatttcttgtcaaaaaaaaa-agtaatatatgttgatttggtattataatatacataat 21429600  T
301 acattatgtacacattacaggacatatacaacactagattattttttatagtgatattgttcctattggtttgcatctccaaaacatactagcagattat 400  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
21429601 acattatgtacacattacaggacatatacaacactagtttattttttatagtgatattgttcctattggtttgcatctccaaaacatactagcagattat 21429700  T
401 tgaaaattg 409  Q
    |||||||||    
21429701 tgaaaattg 21429709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 10 - 109
Target Start/End: Original strand, 16450313 - 16450412
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||  ||||||||||||||||| |||||||| |||||||||||| | ||| ||||||||| ||||||||||||| ||||||||||||||| |||||    
16450313 ttcgattcccagggggaacaacgcttggccagtgcacatgcctctacgcatgagccagattagtcgtccacctttggtaggtcggaaaccggtgcgaaag 16450412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 1 - 108
Target Start/End: Complemental strand, 40780968 - 40780861
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||| | ||||||| ||| |||||||||||||| | ||||||||||||||||||| | ||| | ||||||| ||||||||||||||||||||||||||    
40780968 aatatcgggttcgattctcaaggggaacaacgcttggtcagtgcgcatgcctctacgcatgagccggattagtcgtccacctttggtgggtcggaaaccg 40780869  T
101 gtgagaaa 108  Q
    ||| ||||    
40780868 gtgcgaaa 40780861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 19 - 109
Target Start/End: Original strand, 38166049 - 38166139
Alignment:
19 cagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||||||||||||| ||||||||||||| ||||||| ||||| | ||||||| | ||||||||||||||||||||||||||| |||||    
38166049 cagggggaacaacgcttggccagtgcgcatggctctacgcacgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 38166139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 8 - 109
Target Start/End: Original strand, 2559318 - 2559419
Alignment:
8 gattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaa 107  Q
    ||||||||||  ||| |||||||||||| ||||||||||||||||||||| || || | ||||| | ||||||||||||||||||||||||||||| |||    
2559318 gattcgatttctaggaggaacaacgcttggccagtgcgcatgcctctacgcacaagccggattactcgtccacctttggtgggtcggaaaccggtgcgaa 2559417  T
108 ag 109  Q
    ||    
2559418 ag 2559419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 10 - 103
Target Start/End: Complemental strand, 3159567 - 3159474
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtg 103  Q
    ||||| || ||||||||||||||||| ||||||||||||||||||||| ||||| ||||||||| |  |||| |||||||||||||||||||||    
3159567 ttcgacttccagggggaacaacgcttggccagtgcgcatgcctctacgcacgagccagattagtcgctcaccattggtgggtcggaaaccggtg 3159474  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 10 - 109
Target Start/End: Original strand, 20128322 - 20128421
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||| ||||||||||||| |||| |||||||||||||||| |||| |||||  |||||||| ||||||| |||||||||| |||||||||| |||||    
20128322 ttcgattctcagggggaacaatgcttggccagtgcgcatgcctttacgcacgagctagattagtcgtccaccattggtgggtcagaaaccggtgcgaaag 20128421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 10 - 109
Target Start/End: Original strand, 38075446 - 38075545
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||| ||||||| |||||||||| ||||||||||||||||||||| | ||| |  |||| |||||||||||||||||||||||||||| || |||||    
38075446 ttcgattctcaggggaaacaacgcttggccagtgcgcatgcctctacgcatgagccgaattaattgtccacctttggtgggtcggaaaccgatgcgaaag 38075545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 23 - 109
Target Start/End: Complemental strand, 7246731 - 7246645
Alignment:
23 gggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||||||||| ||||||||||||||||||||| | ||| | ||||||| | ||||||||||||||||||||||||||| |||||    
7246731 gggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 7246645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 22 - 103
Target Start/End: Complemental strand, 49260751 - 49260670
Alignment:
22 ggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtg 103  Q
    |||||||||||||| ||||||||||||||||||||| ||||| | ||||||| | ||||||||||||||||||||| |||||    
49260751 ggggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgaccacctttggtgggtcggaaatcggtg 49260670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 13 - 109
Target Start/End: Complemental strand, 5472943 - 5472847
Alignment:
13 gattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||| ||||||| |||||||||| ||||||||||||||||||||| ||||| | ||||||| | ||||||||||||||||| |||| |||| |||||    
5472943 gattctcaggggaaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcgaaaactggtgcgaaag 5472847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 1 - 109
Target Start/End: Original strand, 30317237 - 30317345
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||||| ||||||| |||| ||||||||||||| |||||| || ||||||||||| ||||| |  |||||| | ||||||||||||||||||||||||    
30317237 aatatcaggttcgattctcagagggaacaacgcttggccagtacgaatgcctctacgcacgagccgaattagtcgcccacctttggtgggtcggaaaccg 30317336  T
101 gtgagaaag 109  Q
     || |||||    
30317337 atgtgaaag 30317345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 1 - 109
Target Start/End: Original strand, 52950086 - 52950194
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||| | |||||||  ||||||||||||||||| ||||||||||||| ||||||  | ||  ||||||||| ||||||||||||||||||||||||||    
52950086 aatatcgggttcgattcccagggggaacaacgcttggccagtgcgcatgactctacacatgaaccagattagtcgtccacctttggtgggtcggaaaccg 52950185  T
101 gtgagaaag 109  Q
     || |||||    
52950186 atgcgaaag 52950194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 10 - 109
Target Start/End: Original strand, 4738631 - 4738730
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||| |||| |||||||||||| ||||||||||||| ||||||| | |||    |||||| ||||||||||||||||||||||||||||| |||||    
4738631 ttcgatttccaggaggaacaacgctttgccagtgcgcatgtctctacgcatgagctgaattagtcgtccacctttggtgggtcggaaaccggtgcgaaag 4738730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 10 - 109
Target Start/End: Original strand, 16645131 - 16645230
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||||||||  ||||||||||| ||||||| ||||||||||||  | ||||| ||||||| | |||||| |||||||||||||||||||| |||||    
16645131 ttcgattttcaggaagaacaacgcttggccagtgtgcatgcctctacacatgagtctgattagtcgcccacctgtggtgggtcggaaaccggtgcgaaag 16645230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 10 - 109
Target Start/End: Original strand, 29895800 - 29895899
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||  ||||||||||||| ||| ||||||||||||||||||||| | ||| | ||||||| ||||||| ||||||| ||||||||||||| |||||    
29895800 ttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgtccaccattggtggttcggaaaccggtgcgaaag 29895899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 8 - 109
Target Start/End: Original strand, 43458624 - 43458725
Alignment:
8 gattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaa 107  Q
    |||||||||  |||| |||| ||||||| ||||||||||||||||||||| ||||| | ||||||| ||||||||||| || ||||||||||| || |||    
43458624 gattcgattcccaggaggaagaacgcttggccagtgcgcatgcctctacggacgagccggattagtcgtccacctttgatgagtcggaaaccgttgcgaa 43458723  T
108 ag 109  Q
    ||    
43458724 ag 43458725  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 1 - 109
Target Start/End: Original strand, 10541020 - 10541127
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||| | |||||||| |||||| |||||||||| ||||||| ||||||||||||| ||||| ||||||| | | ||||||||| ||| ||||||||||    
10541020 aatatcgggttcgatttccaggggaaacaacgcttggccagtgtgcatgcctctacgcacgagccagattaatcg-ccacctttgatggatcggaaaccg 10541118  T
101 gtgagaaag 109  Q
    ||| |||||    
10541119 gtgcgaaag 10541127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 23 - 99
Target Start/End: Complemental strand, 36262852 - 36262776
Alignment:
23 gggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaacc 99  Q
    ||||||||||||| |||||||| |||||||||||| ||||||| ||||||| | |||||||||||||||| ||||||    
36262852 gggaacaacgcttggccagtgcacatgcctctacgcacgagtcggattagtcgcccacctttggtgggtcagaaacc 36262776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 20 - 103
Target Start/End: Original strand, 8889045 - 8889128
Alignment:
20 agggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtg 103  Q
    |||||||||||| ||| | ||||||||||| ||||||| | ||| | ||||||| |||||||||||||||||||||||||||||    
8889045 agggggaacaacacttgggcagtgcgcatggctctacgcatgagccggattagtcgtccacctttggtgggtcggaaaccggtg 8889128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 38 - 109
Target Start/End: Original strand, 14858751 - 14858822
Alignment:
38 ccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||||||| ||||||||||||||||||||| | ||||||||||| |||||| |||||||||| |||||    
14858751 ccagtgcgcatgtctctacgtacgagtcagattattcgtccacctttgatgggtcagaaaccggtgcgaaag 14858822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 10 - 109
Target Start/End: Original strand, 47078471 - 47078570
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||  ||||||||||||||||| |||||||| |||||||||||| ||||| | ||||||| |  |||| ||||||||||||||||| ||| |||||    
47078471 ttcgattcccagggggaacaacgcttggccagtgcacatgcctctacgcacgagccggattagtcgctcaccattggtgggtcggaaaccagtgcgaaag 47078570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 10 - 109
Target Start/End: Original strand, 55921047 - 55921146
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||  ||||||||||||| ||| | ||||||||||||||||||||| ||| | ||||| | |  |||||||||||||||||||||||||| |||||    
55921047 ttcgattcccagggggaacaacacttggtcagtgcgcatgcctctacgtatgagccggattaatcgctcacctttggtgggtcggaaaccggtgcgaaag 55921146  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 1 - 99
Target Start/End: Complemental strand, 40272438 - 40272340
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaacc 99  Q
    |||||| | |||||||| || |||||||||||||| ||||||||||||||||||||| |  |||| |||| || || |||| |||||||||||||||||    
40272438 aatatcgggttcgatttccatggggaacaacgcttggccagtgcgcatgcctctacgcataagtcggatttgtcgttcaccattggtgggtcggaaacc 40272340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 19 - 109
Target Start/End: Complemental strand, 42722666 - 42722576
Alignment:
19 cagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||| |||||||||||| ||||||||||||||||||||| | ||| | ||||||| || ||||||| |||||||| ||||||||| |||||    
42722666 caggaggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgttcacctttagtgggtcgaaaaccggtgcgaaag 42722576  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 3 - 108
Target Start/End: Original strand, 14859297 - 14859402
Alignment:
3 tatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggt 102  Q
    |||| ||||||||||||||| ||||||| | ||  |||||||||||| ||||||| ||||| |||||||||  |||||||||| || ||||||||| |||    
14859297 tatcggattcgattttcaggaggaacaatgtttgaccagtgcgcatgtctctacgcacgagccagattagtcatccacctttgatgtgtcggaaactggt 14859396  T
103 gagaaa 108  Q
    | ||||    
14859397 gcgaaa 14859402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 10 - 99
Target Start/End: Original strand, 20421786 - 20421875
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaacc 99  Q
    |||||||| ||||||||||||| ||| ||||||||||||||||||||| | ||| ||||||| | ||||| | ||| |||||||||||||    
20421786 ttcgatttccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccagattaatcgtccatcattgatgggtcggaaacc 20421875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 1 - 103
Target Start/End: Complemental strand, 1940881 - 1940782
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||| | |||||||  ||||||||||||||||| |   ||||||||||||||||| ||||| | ||||||| | ||||||||||||||||| ||||||    
1940881 aatatcgggttcgattcccagggggaacaacgcttgg---gtgcgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcgaaaaccg 1940785  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 1 - 109
Target Start/End: Original strand, 17946494 - 17946601
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||| ||||||||||||||||||| |||||  |||  ||||||||||||| |||||  | |||||||||||||||||||| ||||||| |||| ||||||    
17946494 aatagcagattcgattttcagggg-aacaattcttgaccagtgcgcatgcttctacacatgagtcagattagttgtccacttttggtgagtcgaaaaccg 17946592  T
101 gtgagaaag 109  Q
     || |||||    
17946593 ttgcgaaag 17946601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 24 - 103
Target Start/End: Complemental strand, 295617 - 295538
Alignment:
24 ggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtg 103  Q
    ||||||||| || ||||||||||||||||||||| ||||  ||||||||| ||||||| |||||||||  ||||||||||    
295617 ggaacaacgtttggccagtgcgcatgcctctacgcacgaaccagattagtcgtccaccgttggtgggtttgaaaccggtg 295538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 19 - 109
Target Start/End: Complemental strand, 3574535 - 3574447
Alignment:
19 cagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||| ||||||| ||| ||||||||||||||||||||| ||||||| ||||||| |  |||||| |||  ||||||||||||||||||||    
3574535 cagggagaacaacacttggccagtgcgcatgcctctacgcacgagtcggattagtcgctcaccttaggt--gtcggaaaccggtgagaaag 3574447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 10 - 97
Target Start/End: Complemental strand, 20532507 - 20532420
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaa 97  Q
    |||||||| |||| |||||||||||| ||||||||||||||||||||| | ||| | ||| ||| | ||||||||||||| |||||||    
20532507 ttcgatttccaggaggaacaacgcttggccagtgcgcatgcctctacgcatgagccggataagtcgcccacctttggtggatcggaaa 20532420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 26 - 109
Target Start/End: Original strand, 24166479 - 24166562
Alignment:
26 aacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||| || ||||||||||||||||||||| ||||| |||||||||   ||||||||| ||| ||||||||||||| |||||    
24166479 aacaacgtttggccagtgcgcatgcctctacgcacgagccagattagtcacccacctttgatggatcggaaaccggtgcgaaag 24166562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 10 - 97
Target Start/End: Original strand, 29588749 - 29588836
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaa 97  Q
    |||||||  |||||| ||||| |||| || |||||||||||||||||| ||||| | |||||||| |||||| |||||||||||||||    
29588749 ttcgattcccaggggaaacaaagcttggctagtgcgcatgcctctacgcacgagccggattagttatccaccattggtgggtcggaaa 29588836  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 19 - 109
Target Start/End: Original strand, 18531541 - 18531631
Alignment:
19 cagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||||||||| ||| | ||||||||||||||| | | ||||  ||||||| | |||||||||| |||||||||||||||||| |||||    
18531541 cagggggaacaacacttggtcagtgcgcatgcctccatgcacgaaccagattattcgtccaccttttgtgggtcggaaaccggtgcgaaag 18531631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 10 - 108
Target Start/End: Original strand, 33647734 - 33647832
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaa 108  Q
    |||||||| ||||| |||||||||||  ||||||| ||| |||||||| ||||  ||||||||| || || ||||||||| ||||||||||||| ||||    
33647734 ttcgatttccagggagaacaacgcttgaccagtgcacattcctctacgcacgaaccagattagtcgttcatctttggtggatcggaaaccggtgcgaaa 33647832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 1 - 109
Target Start/End: Original strand, 14124020 - 14124128
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||| ||| |||||||  |||||||||||||  || ||||||||||||||||||||  ||||| | ||||||| |  |||| ||||||||| ||||||||    
14124020 aataccaggttcgattcccagggggaacaacatttggccagtgcgcatgcctctacacacgagccggattagtcgctcaccattggtgggttggaaaccg 14124119  T
101 gtgagaaag 109  Q
    ||| |||||    
14124120 gtgcgaaag 14124128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 23 - 98
Target Start/End: Original strand, 3507296 - 3507371
Alignment:
23 gggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaac 98  Q
    ||||||||||||| || ||||||| |||||||||  ||||| | ||||||| ||||||||||||||| ||||||||    
3507296 gggaacaacgcttggctagtgcgcgtgcctctacacacgagccggattagtcgtccacctttggtggatcggaaac 3507371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 22 - 109
Target Start/End: Original strand, 17080068 - 17080155
Alignment:
22 ggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||||||||| ||||||||||||||||||||| | ||| | ||||||| |  |||||||| ||| ||| ||||||||| |||||    
17080068 ggggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgcacacctttgatggatcgaaaaccggtgcgaaag 17080155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 22 - 109
Target Start/End: Complemental strand, 47682468 - 47682381
Alignment:
22 ggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||| |||| || |||||||| |||| ||||||| ||||| | | ||||| | ||||||||||||||||||||||||||| |||||    
47682468 ggggaataacgtttggccagtgcacatgtctctacgcacgagccgggttagtcgcccacctttggtgggtcggaaaccggtgcgaaag 47682381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 10 - 109
Target Start/End: Complemental strand, 48015171 - 48015072
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||  ||| ||||||||||||| ||||||||||| ||||||||| ||||| | ||||||| | |||  |||| ||| ||||||||||||| |||||    
48015171 ttcgattcccagtgggaacaacgcttggccagtgcgcaagcctctacgcacgagccggattagtagcccaattttgatggatcggaaaccggtgcgaaag 48015072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 8 - 99
Target Start/End: Complemental strand, 48317375 - 48317284
Alignment:
8 gattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaacc 99  Q
    ||||||||||||||| |||||||||||| | ||||| | ||||||||||| ||||| | ||||||| | ||||| ||| ||||| |||||||    
48317375 gattcgattttcaggaggaacaacgcttggtcagtgtgtatgcctctacgcacgagccggattagtcgcccaccgttgatgggttggaaacc 48317284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 10 - 109
Target Start/End: Original strand, 53599073 - 53599172
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||  |||| ||||||||| || ||||||||||||||||||||| | ||| | ||||| | || ||||||| |||| ||||||||||||| |||||    
53599073 ttcgattcccaggaggaacaacgtttggccagtgcgcatgcctctacgcatgagccggattaatcgttcacctttagtggatcggaaaccggtgcgaaag 53599172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 38 - 108
Target Start/End: Complemental strand, 6032713 - 6032643
Alignment:
38 ccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaa 108  Q
    ||||||| |||||||||||| | ||| | ||||||| ||| ||||||||||||||||||||||||| ||||    
6032713 ccagtgctcatgcctctacgaatgagccggattagtcgtctacctttggtgggtcggaaaccggtgcgaaa 6032643  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 18 - 88
Target Start/End: Original strand, 7741946 - 7742016
Alignment:
18 tcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtg 88  Q
    ||||||| |||||||||| |||||||| |||||||||||| ||||  ||||||||| ||||| ||||||||    
7741946 tcaggggtaacaacgcttggccagtgcacatgcctctacgcacgatccagattagtcgtccatctttggtg 7742016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 22 - 108
Target Start/End: Original strand, 13073563 - 13073649
Alignment:
22 ggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaa 108  Q
    ||||||||| | || |||||||||||| |||||||| | ||  ||||||||| ||  ||||||||||||||||||||||||| ||||    
13073563 ggggaacaatgtttggccagtgcgcatacctctacgcatgaaccagattagtcgtttacctttggtgggtcggaaaccggtgcgaaa 13073649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 22 - 100
Target Start/End: Original strand, 46108716 - 46108794
Alignment:
22 ggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    ||||||||||  || || |||||||||||||||||| | ||| ||||||||| |||||| |||| ||||||||||||||    
46108716 ggggaacaacatttggctagtgcgcatgcctctacgcatgagccagattagtcgtccacttttgatgggtcggaaaccg 46108794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 24 - 109
Target Start/End: Original strand, 21192667 - 21192752
Alignment:
24 ggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||||| |  ||||||||||||||||||||| ||||||| ||||| | | |||| ||||||| |||| ||||||||| |||||    
21192667 ggaacaacgttgggccagtgcgcatgcctctacgcacgagtcggattaatcgcccacatttggtgagtcgaaaaccggtgcgaaag 21192752  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #49
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 24 - 109
Target Start/End: Original strand, 38168284 - 38168368
Alignment:
24 ggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||||||| |||||||| |||||||||||| | ||| | ||||||| || ||||||| |||||| ||||||||||| |||||    
38168284 ggaacaacgcttggccagtgc-catgcctctacgcatgagccggattagtcgttcacctttagtgggttggaaaccggtgcgaaag 38168368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #50
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 37 - 109
Target Start/End: Original strand, 14567279 - 14567351
Alignment:
37 gccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||||||||||||||||| ||||| | ||||||| |  | |||||||||||||||||| ||||| |||||    
14567279 gccagtgcgcatgcctctacgcacgagccggattagtcgctcgcctttggtgggtcggaaatcggtgcgaaag 14567351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #51
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 10 - 81
Target Start/End: Original strand, 1446839 - 1446910
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacc 81  Q
    |||||||  ||||||||||||| ||| ||||||||||||||||||||| | ||| | ||||||| |||||||    
1446839 ttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgtccacc 1446910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #52
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 10 - 109
Target Start/End: Original strand, 6779224 - 6779323
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||  ||||||||||||| | | ||||||||||||||||||| | | ||| | ||||||| ||||||||||||||  |||||| ||| || |||||    
6779224 ttcgattcccagggggaacaacacctggccagtgcgcatgcctctatgcatgagccggattagtcgtccacctttggtgaatcggaacccgatgcgaaag 6779323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #53
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 22 - 109
Target Start/End: Complemental strand, 15732534 - 15732447
Alignment:
22 ggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||||| ||| |||||||| |||||||||||| ||| |  |||||||| |  || ||||||||| ||||||||||||| |||||    
15732534 ggggaacaacacttggccagtgcacatgcctctacgcacgggctagattagtcgctcatctttggtggatcggaaaccggtgcgaaag 15732447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #54
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 13 - 80
Target Start/End: Original strand, 20354653 - 20354720
Alignment:
13 gattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccac 80  Q
    ||||| ||||| ||||||||||| || |||||||||||||||||| | ||||| ||||||| ||||||    
20354653 gatttccagggagaacaacgcttggctagtgcgcatgcctctacgcatgagtcggattagtcgtccac 20354720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #55
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 19 - 109
Target Start/End: Original strand, 27248450 - 27248538
Alignment:
19 cagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||| |||||||||||| |||||  |||||||||||||| | ||| ||||||||| | ||||||||||| |||| ||||| |||| |||||    
27248450 caggaggaacaacgcttggccag--cgcatgcctctacgcaggagccagattagtcgcccacctttggtaggtcagaaactggtgtgaaag 27248538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #56
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 10 - 109
Target Start/End: Original strand, 35359749 - 35359848
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||| ||||||||||||||| ||  |||||||||||||||| ||| |  |||  ||||||| | ||||  | ||||||||||||||||||| |||||    
35359749 ttcgattctcagggggaacaacgtttgaccagtgcgcatgcctcaacgcataagttggattagtcgcccactataggtgggtcggaaaccggtgcgaaag 35359848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #57
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 10 - 109
Target Start/End: Complemental strand, 36145313 - 36145214
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||  |||||| ||||||||||   ||||||||||||||||||  | ||| | ||||||| ||||||||||| ||  ||||||||||||| |||||    
36145313 ttcgattcccaggggaaacaacgcttgatcagtgcgcatgcctctacacatgagccggattagtcgtccacctttgatgaatcggaaaccggtgcgaaag 36145214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #58
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 10 - 109
Target Start/End: Original strand, 43468360 - 43468459
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||  ||||||||||||||||| |||||||| |||  ||||||| | ||| | ||||||| | |||||  |||||||||||| ||||||| |||||    
43468360 ttcgattcccagggggaacaacgcttggccagtgcacatttctctacgcatgagccggattagtcgcccaccagtggtgggtcggagaccggtgcgaaag 43468459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #59
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 14 - 109
Target Start/End: Original strand, 45721103 - 45721198
Alignment:
14 attttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||||||| || || | || |||| ||||| |||||||||| || |||| ||||||| ||||||||||  ||||| ||||||||||| |||||    
45721103 attttcaggggaaataatgtttggccactgcgcgtgcctctacgcacaagtcggattagtcgtccacctttaatgggttggaaaccggtgcgaaag 45721198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #60
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 13 - 109
Target Start/End: Original strand, 15829715 - 15829811
Alignment:
13 gattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||||||| | |||| ||| |||||||||||||| |||| | | ||| | |||||||  |||||| ||||||| || |||||||||| |||||    
15829715 gattttcaggggaatcaacacttggccagtgcgcatgcttctaggcatgagccggattagtcctccaccattggtggatcagaaaccggtgcgaaag 15829811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #61
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 12 - 109
Target Start/End: Complemental strand, 25406662 - 25406562
Alignment:
12 cgattttcagggggaacaacgcttagccagtgcgcatgcctc----tacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaa 107  Q
    ||||||||||||| ||||| | || |||||||||| ||||||    |||| | || |||||||||| || |||||||| ||||||||||||||||| |||    
25406662 cgattttcaggggtaacaatgtttggccagtgcgc-tgcctcgctctacgcatgaatcagattagtcgttcacctttgatgggtcggaaaccggtgcgaa 25406564  T
108 ag 109  Q
    ||    
25406563 ag 25406562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #62
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 37 - 109
Target Start/End: Complemental strand, 48834771 - 48834699
Alignment:
37 gccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||| ||||||||||   | ||||| ||||||| | | ||||||||||||||||||||||||| |||||    
48834771 gccagtgcacatgcctctatacatgagtcggattagtcgcctacctttggtgggtcggaaaccggtgcgaaag 48834699  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #63
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 22 - 109
Target Start/End: Complemental strand, 42722465 - 42722378
Alignment:
22 ggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||||| |||  ||||||||||| |||||| | | ||||| ||||||| |||||||  |||||||||| ||| ||||| |||||    
42722465 ggggaacaacacttgaccagtgcgcatacctctatgcatgagtcggattagtcgtccaccaatggtgggtcgaaaatcggtgcgaaag 42722378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #64
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 25 - 100
Target Start/End: Original strand, 50485971 - 50486046
Alignment:
25 gaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||||| || |||||  |||||||||||||| ||||| | ||||||| | ||||| || |||||||||||||||    
50485971 gaacaacgattggccagaacgcatgcctctacgcacgagccggattagtcgcccaccattagtgggtcggaaaccg 50486046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #65
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 37 - 103
Target Start/End: Complemental strand, 14597971 - 14597905
Alignment:
37 gccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtg 103  Q
    ||||||||||||||||||||| ||||    ||||||| ||||||||||| ||| ||| |||||||||    
14597971 gccagtgcgcatgcctctacgcacgaactggattagtcgtccacctttgatggatcgaaaaccggtg 14597905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #66
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 26 - 98
Target Start/End: Original strand, 4736626 - 4736698
Alignment:
26 aacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaac 98  Q
    ||||||| || |||| || |||||||||||||||| || |  |||||| | ||||| ||||||||||||||||    
4736626 aacaacgtttggccaatgtgcatgcctctacgtacaagccgaattagtcgcccaccgttggtgggtcggaaac 4736698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #67
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 10 - 98
Target Start/End: Complemental strand, 26237520 - 26237432
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaac 98  Q
    ||||||| ||||||| ||||||| ||   ||||||| ||| || |||| | ||||| ||||||| ||||||| ||| ||||||||||||    
26237520 ttcgattctcaggggaaacaacgtttgatcagtgcgtatgtctttacgcatgagtcggattagtagtccaccattgatgggtcggaaac 26237432  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #68
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 61 - 109
Target Start/End: Complemental strand, 27531717 - 27531669
Alignment:
61 gagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||| || |||| |||||||||||||||||||||| |||||| |||||    
27531717 gagtcggaatagtcgtccacctttggtgggtcggaagccggtgtgaaag 27531669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #69
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 22 - 86
Target Start/End: Complemental strand, 41339481 - 41339417
Alignment:
22 ggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttgg 86  Q
    |||||||||||||| ||||||| | ||||||||||| ||||| | ||||||| | ||||| ||||    
41339481 ggggaacaacgcttggccagtgtgtatgcctctacgcacgagacggattagtcgcccaccattgg 41339417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #70
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 25 - 97
Target Start/End: Original strand, 53354560 - 53354632
Alignment:
25 gaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaa 97  Q
    ||||||| |||| |||||||||||||||||||| |  | || ||||||| || || ||||| |||||||||||    
53354560 gaacaacacttaaccagtgcgcatgcctctacgcataaatcggattagtcgttcatctttgatgggtcggaaa 53354632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #71
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 9 - 73
Target Start/End: Complemental strand, 55005405 - 55005341
Alignment:
9 attcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagt 73  Q
    ||||||||  |||||| ||||||||||  ||| |||||||||||||||| || |||| |||||||    
55005405 attcgattcgcaggggaaacaacgcttgaccattgcgcatgcctctacgcacaagtcggattagt 55005341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 66; Significance: 5e-29; HSPs: 66)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 20 - 109
Target Start/End: Complemental strand, 25540492 - 25540403
Alignment:
20 agggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||||||||||| ||||||||||||||||||||| ||||| | ||||||| ||||||||||||||||||||||||||||| |||||    
25540492 agggggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgtccacctttggtgggtcggaaaccggtgcgaaag 25540403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 6358258 - 6358150
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||| |||||||||||| ||||||||||||| ||| ||||||||||||||||||||| | ||| | ||||||| ||||||| ||||||||||| ||||||    
6358258 aataccagattcgatttccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgtccaccattggtgggtcgaaaaccg 6358159  T
101 gtgagaaag 109  Q
    ||| |||||    
6358158 gtgtgaaag 6358150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 10 - 109
Target Start/End: Original strand, 12455318 - 12455417
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||| |||||| |||||||||||||||||||||||||||||||| ||||| | ||||||| |  |||| ||||||||||||||||||||| |||||    
12455318 ttcgatttccaggggaaacaacgcttagccagtgcgcatgcctctacgcacgagccggattagtcgctcaccattggtgggtcggaaaccggtgcgaaag 12455417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 8 - 109
Target Start/End: Original strand, 12864230 - 12864331
Alignment:
8 gattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaa 107  Q
    |||||||||| ||||||||||||| ||| | |||||||||||||||| || | ||| ||||||||| ||||||| ||||||||||||||||||||| |||    
12864230 gattcgatttccagggggaacaacacttggtcagtgcgcatgcctctgcgcatgagccagattagtcgtccaccattggtgggtcggaaaccggtgcgaa 12864329  T
108 ag 109  Q
    ||    
12864330 ag 12864331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 10 - 109
Target Start/End: Original strand, 16325603 - 16325702
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||  ||||||||||||| ||| ||||||| ||||||||||||| | ||| ||||||||| ||||||| ||||||||||||||||||||| |||||    
16325603 ttcgattcccagggggaacaacacttggccagtgtgcatgcctctacgcatgagccagattagtcgtccaccattggtgggtcggaaaccggtgcgaaag 16325702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 10 - 109
Target Start/End: Original strand, 38962771 - 38962870
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||||||||| |||||||||||| ||||||||||||||||||||| | ||  | ||||||| |||||||||||||||||| ||||| |||| |||||    
38962771 ttcgattttcaggaggaacaacgcttggccagtgcgcatgcctctacgcatgaaccggattagtcgtccacctttggtgggtcagaaactggtgcgaaag 38962870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 19 - 109
Target Start/End: Original strand, 10823077 - 10823167
Alignment:
19 cagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||| |||||||||||| ||||||||||||||||||||| ||||| | ||||||| | |||||||| |||||||||||||||||| |||||    
10823077 caggaggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgcccaccttttgtgggtcggaaaccggtgcgaaag 10823167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 1 - 109
Target Start/End: Original strand, 8410130 - 8410238
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||| | |||||||  ||||||||||||| ||| ||||||||||||||||||||| ||||| | ||||||| | |||| ||||| |||||||||||||    
8410130 aatatcgggttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcacgagccggattagtcgcccacttttggggggtcggaaaccg 8410229  T
101 gtgagaaag 109  Q
    ||| |||||    
8410230 gtgcgaaag 8410238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 10 - 98
Target Start/End: Complemental strand, 10026714 - 10026626
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaac 98  Q
    ||||||| ||||||||||||||| || ||||||||||||||||||||| | ||| | ||||||| | ||||||||||||||||||||||    
10026714 ttcgattctcagggggaacaacgtttggccagtgcgcatgcctctacgcatgagccggattagtcgaccacctttggtgggtcggaaac 10026626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 19 - 103
Target Start/End: Original strand, 10669609 - 10669693
Alignment:
19 cagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtg 103  Q
    ||||| ||||||||||| ||||||||||||| ||||||| ||||||| ||||| | || ||||||||||||||||||||||||||    
10669609 cagggagaacaacgcttggccagtgcgcatgtctctacgcacgagtcggattaatcgttcacctttggtgggtcggaaaccggtg 10669693  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 28616486 - 28616378
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||| | |||||||||||||||||| ||| ||| | ||||||||||||||||||| ||||| ||||||||| | ||| |||| ||||||| |||||||    
28616486 aatatcgggttcgattttcagggggaataacacttgggcagtgcgcatgcctctacgcacgagccagattagtcgcccatctttagtgggtcagaaaccg 28616387  T
101 gtgagaaag 109  Q
    ||| |||||    
28616386 gtgcgaaag 28616378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 13 - 109
Target Start/End: Complemental strand, 34346382 - 34346286
Alignment:
13 gattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||| |||||||||||||| ||| ||||||| ||||||||||||| | ||||||||||| | |  |||||||||||||||||||||||||| |||||    
34346382 gattatcagggggaacaacacttggccagtgtgcatgcctctacgcatgagtcagattaatcgctcacctttggtgggtcggaaaccggtgcgaaag 34346286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 22 - 109
Target Start/End: Complemental strand, 18902616 - 18902529
Alignment:
22 ggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||||||||||  ||||||||| || ||||||| ||||| ||||||||| | ||||||||||||||||||||||||||| |||||    
18902616 ggggaacaacgcttgaccagtgcgcgtgtctctacgcacgagccagattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 18902529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 9 - 104
Target Start/End: Complemental strand, 39201607 - 39201512
Alignment:
9 attcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtga 104  Q
    |||||||| ||||||||||||| | || ||||||| ||||||||||||| | ||| | ||||||| || |||||||||||||||||||||||||||    
39201607 attcgattctcagggggaacaatgtttggccagtgtgcatgcctctacgcatgagccggattagtcgttcacctttggtgggtcggaaaccggtga 39201512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 10 - 109
Target Start/End: Original strand, 44139492 - 44139591
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||  ||||||||||||||||| |||||||||| |||||||||| ||||| | ||||||| | |||||  |||||||||||||||||||| |||||    
44139492 ttcgattcccagggggaacaacgcttggccagtgcgcgtgcctctacgcacgagccggattagtcgcccaccaatggtgggtcggaaaccggtgcgaaag 44139591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 18 - 100
Target Start/End: Complemental strand, 42770741 - 42770659
Alignment:
18 tcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||||||||||||||| |||||||||||||||||| || ||||| | ||||| | ||||||||||||||||||| ||||||    
42770741 tcagggggaacaacgcttggccagtgcgcatgcctcttcgcacgagccggattaatcgtccacctttggtgggtcgaaaaccg 42770659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 1 - 109
Target Start/End: Original strand, 37560172 - 37560280
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||| ||| ||||||| ||| ||||||||||| || | ||||||||||||||||||| ||||| | ||||| | ||||||||||| ||||||| ||||||    
37560172 aataccaggttcgattctcaaggggaacaacgtttggtcagtgcgcatgcctctacgcacgagccggattaatcgtccacctttgatgggtcgaaaaccg 37560271  T
101 gtgagaaag 109  Q
    ||| |||||    
37560272 gtgtgaaag 37560280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 10 - 109
Target Start/End: Original strand, 22593143 - 22593240
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||  |||||||||||||| || ||||||||||||||||||||| | ||| | ||||||| |||||||||||||||||||| |||||||| |||||    
22593143 ttcgattcccagggggaacaacg-ttggccagtgcgcatgcctctacgcatgagccggattagtcgtccacctttggtgggtcgg-aaccggtgcgaaag 22593240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 22 - 109
Target Start/End: Original strand, 35946758 - 35946845
Alignment:
22 ggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||||||||| |||| || ||||||||||||| ||||| | ||||||| ||||||| |||||||||||||||| |||| |||||    
35946758 ggggaacaacgcttggccattgtgcatgcctctacgcacgagccggattagtcgtccaccattggtgggtcggaaactggtgcgaaag 35946845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 10 - 109
Target Start/End: Complemental strand, 41032004 - 41031905
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||  ||||||||||||| ||| ||||||| ||||||||||||| ||||| | |||||||   ||||||||||||||||||||||| ||| |||||    
41032004 ttcgattcccagggggaacaacacttggccagtgtgcatgcctctacgcacgagccggattagtcacccacctttggtgggtcggaaaccagtgcgaaag 41031905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 10 - 109
Target Start/End: Original strand, 41220643 - 41220742
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||  |||| |||||||||||| ||||||||||||||||||||| | ||| |  |||||| || ||||||| |||||||||||||||||| |||||    
41220643 ttcgattcccaggaggaacaacgcttggccagtgcgcatgcctctacgcatgagccgaattagtcgttcacctttagtgggtcggaaaccggtgcgaaag 41220742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 24 - 109
Target Start/End: Complemental strand, 3643971 - 3643886
Alignment:
24 ggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||||||| ||||||||||||||||||||| | |||   ||||||| |||||||||||||||| ||||||||| || |||||    
3643971 ggaacaacgcttggccagtgcgcatgcctctacgcatgagctggattagtcgtccacctttggtgggccggaaaccgttgcgaaag 3643886  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 14169716 - 14169608
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||| | ||||||| || ||||||||||| |||  |||||||||||| ||||||| | ||| | ||||||| ||| ||| ||||||||||||||||||    
14169716 aatatcgggttcgattctccgggggaacaacacttgaccagtgcgcatgtctctacgcatgagccggattagtcgtctaccattggtgggtcggaaaccg 14169617  T
101 gtgagaaag 109  Q
    ||| |||||    
14169616 gtgcgaaag 14169608  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 13 - 109
Target Start/End: Original strand, 27725951 - 27726047
Alignment:
13 gattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||| ||||| ||||||| |||| ||||||||||||||||||||| || || | ||||||| | |||||  |||||||||||||||||||| |||||    
27725951 gattctcaggaggaacaatgcttggccagtgcgcatgcctctacgcactagccggattagtcgcccaccaatggtgggtcggaaaccggtgtgaaag 27726047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 10 - 109
Target Start/End: Complemental strand, 28525554 - 28525454
Alignment:
10 ttcgattttcagggggaa-caacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaa 108  Q
    |||||||| ||||||||| |||| ||| ||||||||||||||||||||| ||||| | |||||||  |||||||||  |||||||||||| |||| ||||    
28525554 ttcgatttccagggggaaacaacacttggccagtgcgcatgcctctacgcacgagccggattagtcatccacctttaatgggtcggaaactggtgtgaaa 28525455  T
109 g 109  Q
    |    
28525454 g 28525454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 10 - 109
Target Start/End: Complemental strand, 15234159 - 15234060
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||| |||||||||||||| |||  |||||||||||||||||||| || ||| |||||||| || || ||||| | |||||||||||| || |||||    
15234159 ttcgattctcagggggaacaacacttgaccagtgcgcatgcctctacgcacaagttagattagtcgttcatctttgataggtcggaaaccgatgcgaaag 15234060  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 10 - 109
Target Start/End: Original strand, 16034945 - 16035044
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||||||||| ||||||||||||  |||||| |||||||| |||||||||| | ||||||| |  |||| ||| || |||||||||||||| |||||    
16034945 ttcgattttcaggcggaacaacgcttgaccagtgtgcatgcctatacgtacgagccggattagtcgctcaccattgatgagtcggaaaccggtgcgaaag 16035044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 8 - 99
Target Start/End: Complemental strand, 37804991 - 37804900
Alignment:
8 gattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaacc 99  Q
    |||||||||  ||||||||| ||||||| || |||||||||||| ||||| | |||||||||| |||| ||||| ||| |||||||||||||    
37804991 gattcgattcacagggggaataacgcttggctagtgcgcatgccgctacgcatgagtcagatttgttgcccaccattgatgggtcggaaacc 37804900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 22 - 109
Target Start/End: Original strand, 38005422 - 38005509
Alignment:
22 ggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||||||||| ||||||||||||||||||||  | ||| | ||||||| | ||||||||||||| |||||||| |||| |||||    
38005422 ggggaacaacgcttggccagtgcgcatgcctctacacatgagccggattagtcgcccacctttggtggatcggaaactggtgcgaaag 38005509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 1 - 71
Target Start/End: Complemental strand, 18846328 - 18846258
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagatta 71  Q
    |||||| ||||| ||||||||||| |||||||||| | |||||||||||||| |||||||||| |||||||    
18846328 aatatctgattcaattttcaggggaaacaacgcttgggcagtgcgcatgcctttacgtacgagccagatta 18846258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 10 - 99
Target Start/End: Original strand, 331509 - 331598
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaacc 99  Q
    |||||||  ||||||||||||| ||| |||||||||||||| |||||| | ||| | ||||||| | ||||||||||||||| |||||||    
331509 ttcgattcccagggggaacaacacttggccagtgcgcatgcttctacgcatgagccggattagtcgcccacctttggtgggttggaaacc 331598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 24 - 109
Target Start/End: Original strand, 7747296 - 7747381
Alignment:
24 ggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||||| || ||||||| ||||||||||||| | ||| | ||||||| || ||||||| |||||||||||||||||| |||||    
7747296 ggaacaacgtttggccagtgtgcatgcctctacgcatgagccggattagtcgttcacctttagtgggtcggaaaccggtgcgaaag 7747381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 10 - 103
Target Start/End: Original strand, 7787064 - 7787157
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtg 103  Q
    |||||||| ||||||||||||  ||| |||||| |||||||||||||| ||||| | ||||||| | ||| ||||||||| ||| |||||||||    
7787064 ttcgatttccagggggaacaatacttggccagtacgcatgcctctacgcacgagccggattagtcgcccatctttggtggatcgaaaaccggtg 7787157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 20 - 109
Target Start/End: Original strand, 11069896 - 11069985
Alignment:
20 agggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||||||||| || |||||||||||| |||||||| |||||    |||||| ||||||| |||||||||||||||||| || |||||    
11069896 agggggaacaacgtttggccagtgcgcatacctctacgcacgagctgaattagtcgtccaccgttggtgggtcggaaaccgatgcgaaag 11069985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 24 - 109
Target Start/End: Complemental strand, 20116696 - 20116611
Alignment:
24 ggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||||| | |||| |||||||||||||||| | ||| | ||||||  ||||||||||| ||||||||||||||||| |||||    
20116696 ggaacaacgcatggccaatgcgcatgcctctacgcatgagccggattagccgtccacctttgatgggtcggaaaccggtgcgaaag 20116611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 24 - 109
Target Start/End: Original strand, 44945615 - 44945700
Alignment:
24 ggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||||||| |  |||||||||||||||||| ||||| | ||||||| | |||||||| |||| ||||||||||||| |||||    
44945615 ggaacaacgcttggatagtgcgcatgcctctacgcacgagccggattagtcgcccacctttagtggatcggaaaccggtgcgaaag 44945700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 1 - 109
Target Start/End: Original strand, 2550867 - 2550975
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||| | |||||||  |||| |||||||| ||||||||||||||||| ||||||| | ||| | ||||||| | |||| |||||||||| | ||||||    
2550867 aatatcgggttcgattcccaggaggaacaacacttagccagtgcgcatgtctctacgcatgagccggattagtcgcccacttttggtgggttgaaaaccg 2550966  T
101 gtgagaaag 109  Q
    ||| |||||    
2550967 gtgcgaaag 2550975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 10 - 108
Target Start/End: Complemental strand, 20612634 - 20612534
Alignment:
10 ttcgattttcagg-gggaacaacgcttagccagtgcgcatgcctctacgtacgagtc-agattagttgtccacctttggtgggtcggaaaccggtgagaa 107  Q
    ||||||| ||||| ||||||||| ||| ||||||||||||||||||| | | ||| |  ||||||| ||||||| ||||||||||||||||||||| |||    
20612634 ttcgattctcaggagggaacaacacttggccagtgcgcatgcctctatgcatgagccgggattagtcgtccaccattggtgggtcggaaaccggtgcgaa 20612535  T
108 a 108  Q
    |    
20612534 a 20612534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #39
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 26 - 109
Target Start/End: Complemental strand, 9360830 - 9360747
Alignment:
26 aacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||| || ||||||||||||||||||||| ||||| |  |||||| | |||||||| ||||| |||||||||||| |||||    
9360830 aacaacgtttggccagtgcgcatgcctctacgcacgagccgaattagtcgcccacctttagtgggccggaaaccggtgcgaaag 9360747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #40
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 22 - 109
Target Start/End: Original strand, 33005771 - 33005858
Alignment:
22 ggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||||| ||| ||||||||||||||||||||| | ||| ||||||| | |  ||||||| ||||||||||||||| || |||||    
33005771 ggggaacaacacttggccagtgcgcatgcctctacgcatgaggcagattaatcgctcacctttagtgggtcggaaaccgatgcgaaag 33005858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #41
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 10 - 109
Target Start/End: Original strand, 34722688 - 34722787
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||| |||||| ||||||||||| | |||||| |||| ||||||| ||||| | ||||||| | ||||||||| ||| || |||||||||| |||||    
34722688 ttcgattctcagggagaacaacgcttggtcagtgcacatgtctctacgcacgagccggattagtcgcccacctttgatggatcagaaaccggtgcgaaag 34722787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #42
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 26 - 109
Target Start/End: Complemental strand, 39806967 - 39806884
Alignment:
26 aacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||| || ||||||||||||||||||||  ||||||| |||||||  |||||||||||||| ||  ||||||||| |||||    
39806967 aacaacgtttggccagtgcgcatgcctctacacacgagtcggattagtcatccacctttggtggttcataaaccggtgcgaaag 39806884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #43
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 1 - 103
Target Start/End: Complemental strand, 31740868 - 31740766
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||| ||||||||||| ||||||   ||||||||| | ||||||| |||| |||| | |||||||||| |||| ||||||||||||||| ||| |||| |    
31740868 aataccagattcgattatcagggattacaacgcttggtcagtgcgaatgcttctaggcacgagtcagactagtcgtccacctttggtggatcgaaaactg 31740769  T
101 gtg 103  Q
    |||    
31740768 gtg 31740766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #44
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 39 - 108
Target Start/End: Original strand, 2784969 - 2785038
Alignment:
39 cagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaa 108  Q
    ||||||||||||||||||| | ||||||||||||| ||||| | ||| || |||||||||||||| ||||    
2784969 cagtgcgcatgcctctacgcatgagtcagattagtcgtccatcattgatgagtcggaaaccggtgcgaaa 2785038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #45
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 10 - 98
Target Start/End: Complemental strand, 10046574 - 10046487
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaac 98  Q
    ||||||| ||| ||| ||||||| || | ||||||||||||||||||| | ||| | ||||||| | ||||||||||||||||||||||    
10046574 ttcgattctcaagggaaacaacgttt-gacagtgcgcatgcctctacgcatgagccggattagtcgaccacctttggtgggtcggaaac 10046487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #46
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 12 - 100
Target Start/End: Original strand, 26805306 - 26805394
Alignment:
12 cgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    ||||||||||| | ||| ||| || |||||||| |||||||||||| | ||||| ||||||| | ||||||||||||| ||| ||||||    
26805306 cgattttcaggagaaacgacgtttggccagtgcacatgcctctacgcatgagtcggattagtcgcccacctttggtggctcgaaaaccg 26805394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #47
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 10 - 109
Target Start/End: Original strand, 29422223 - 29422322
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||| ||| ||||||||| ||| |||| || |||| ||| |||| ||||| | ||||||| ||||||||||| ||| ||||||| ||||| |||||    
29422223 ttcgatttccagagggaacaacacttggccaatgagcatacctttacgcacgagccggattagtcgtccacctttgatggatcggaaatcggtgcgaaag 29422322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #48
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 10 - 93
Target Start/End: Complemental strand, 45263765 - 45263682
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcg 93  Q
    |||||||  ||| ||||||||||||| ||||||||||||||||||||| ||||| | ||||| | |  || |||||||||||||    
45263765 ttcgattcccagagggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattaatcgctcatctttggtgggtcg 45263682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #49
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 8 - 90
Target Start/End: Original strand, 29653633 - 29653714
Alignment:
8 gattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtggg 90  Q
    |||||||||| |||||  |||||||||| | ||||||||||||||||||| ||||| |  |||||| | ||||||||||||||    
29653633 gattcgatttccagggaaaacaacgcttgggcagtgcgcatgcctctacgcacgagccgaattagtcg-ccacctttggtggg 29653714  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #50
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 1 - 54
Target Start/End: Complemental strand, 14853474 - 14853421
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctct 54  Q
    |||| ||||||||||||||||||||||||||  || ||||||||| ||||||||    
14853474 aataccagattcgattttcagggggaacaacttttggccagtgcgtatgcctct 14853421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #51
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 8 - 109
Target Start/End: Complemental strand, 18649126 - 18649025
Alignment:
8 gattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaa 107  Q
    ||||||||| ||||| |||||||   || | ||||||||||||||||||| | ||||| ||||||| |  ||| |||||||||| |||||||| || |||    
18649126 gattcgattctcaggaggaacaatatttgggcagtgcgcatgcctctacgcatgagtcggattagtcgctcacttttggtgggttggaaaccgttgcgaa 18649027  T
108 ag 109  Q
    ||    
18649026 ag 18649025  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #52
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 22 - 91
Target Start/End: Original strand, 24179588 - 24179657
Alignment:
22 ggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggt 91  Q
    ||||||||||| || |||||||| |||||||||||| | ||| | ||||||| ||||| |||||||||||    
24179588 ggggaacaacgtttggccagtgcacatgcctctacgcatgagccggattagtcgtccatctttggtgggt 24179657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #53
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 3811798 - 3811690
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||| | |||||||  ||| ||||||||| ||| | || |||||||||||||||| | ||| | ||||| | | |||||||||||||||| |||||||    
3811798 aatatcgggttcgattcccagagggaacaacacttggtcaatgcgcatgcctctacgcatgagccggattactcgcccacctttggtgggtcagaaaccg 3811699  T
101 gtgagaaag 109  Q
     || |||||    
3811698 atgcgaaag 3811690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #54
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 25 - 109
Target Start/End: Complemental strand, 13104908 - 13104824
Alignment:
25 gaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||||||| ||||||||||||||||||||| | |||  | |||||| ||| ||||||| | ||||| |||| |||| |||||    
13104908 gaacaacgcttggccagtgcgcatgcctctacgcatgagctaaattagtcgtctacctttgataggtcgaaaactggtgtgaaag 13104824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #55
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 10 - 98
Target Start/End: Original strand, 34356214 - 34356302
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaac 98  Q
    |||||||| ||||||||||||| ||| | ||||||||||||||||| | | ||| | ||||| | || |||| ||| ||||||||||||    
34356214 ttcgatttccagggggaacaacacttggtcagtgcgcatgcctctatgcatgagccggattaatcgtgcaccattgatgggtcggaaac 34356302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #56
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 47 - 103
Target Start/End: Complemental strand, 34738394 - 34738338
Alignment:
47 atgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtg 103  Q
    ||||||||||| ||||||| ||||||| |||||||  |||| |||||||||||||||    
34738394 atgcctctacgcacgagtcggattagtcgtccaccaatggtaggtcggaaaccggtg 34738338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #57
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 1 - 100
Target Start/End: Complemental strand, 13026518 - 13026419
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||| | ||||||| ||||| ||||||| | || ||||||||||||||||||||| | ||| | |||||||   |||| |||||| |||| |||||||    
13026518 aatatcgggttcgattatcaggaggaacaatgattggccagtgcgcatgcctctacgcatgagccggattagtcagccacttttggtaggtcagaaaccg 13026419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #58
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 10 - 73
Target Start/End: Original strand, 15079491 - 15079554
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagt 73  Q
    |||||||| |||||||||||||||||  |||||| ||||| ||||||| ||||| || ||||||    
15079491 ttcgatttccagggggaacaacgcttgaccagtgtgcatgactctacgcacgagccaaattagt 15079554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #59
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 10 - 109
Target Start/End: Complemental strand, 19976905 - 19976806
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||||||||||||| |||| || | ||||||||||| ||||||| |  ||||  |||||| | ||||||||| ||  ||||||| ||||| |||||    
19976905 ttcgattttcagggggaataacgtttggtcagtgcgcatgtctctacgcataagtcgaattagtcgcccacctttgatgaatcggaaatcggtgcgaaag 19976806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #60
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 46 - 100
Target Start/End: Complemental strand, 20963172 - 20963118
Alignment:
46 catgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||||||||||| ||| ||||||||| | ||||||||| ||||||| ||||||    
20963172 catgcctctacgtatgaggcagattagtcgcccacctttgatgggtcgaaaaccg 20963118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #61
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 43303399 - 43303345
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctcta 55  Q
    |||||| | ||||||||||| ||||||||||||||  ||||| ||||||||||||    
43303399 aatatcgggttcgattttcaaggggaacaacgcttgaccagtacgcatgcctcta 43303345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #62
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 26 - 99
Target Start/End: Complemental strand, 4080399 - 4080326
Alignment:
26 aacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaacc 99  Q
    ||||||||||  ||||| |||||||||| ||| |||| ||||||||||||  ||||  |||||||||| |||||    
4080399 aacaacgcttgaccagtacgcatgcctccacgcacgaatcagattagttgctcaccaatggtgggtcgaaaacc 4080326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #63
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 40 - 84
Target Start/End: Complemental strand, 3042571 - 3042527
Alignment:
40 agtgcgcatgcctctacgtacgagtcagattagttgtccaccttt 84  Q
    ||||||||||||||||||| |||| ||||||||| ||||| ||||    
3042571 agtgcgcatgcctctacgtgcgaggcagattagtcgtccatcttt 3042527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #64
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 77 - 109
Target Start/End: Original strand, 29299353 - 29299385
Alignment:
77 ccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||||||||||||||||||||||| |||||    
29299353 ccacctttggtgggtcggaaaccggtgcgaaag 29299385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #65
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 21 - 73
Target Start/End: Complemental strand, 30721942 - 30721890
Alignment:
21 gggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagt 73  Q
    ||||||||||| ||| | ||||||||||| ||||||||| ||||| |||||||    
30721942 gggggaacaacacttggtcagtgcgcatgtctctacgtatgagtcggattagt 30721890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #66
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 34130408 - 34130301
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||||| ||||||||||| || |||||||| ||  ||| ||| |||| ||||||| | ||| ||||||||| ||| ||| ||||| | ||||||| ||    
34130408 aatatcaggttcgattttca-ggagaacaacgtttgaccattgcacatgtctctacgcatgagccagattagtcgtctaccattggtagatcggaaatcg 34130310  T
101 gtgagaaag 109  Q
    ||| |||||    
34130309 gtgcgaaag 34130301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0170 (Bit Score: 65; Significance: 2e-28; HSPs: 1)
Name: scaffold0170
Description:

Target: scaffold0170; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 8 - 104
Target Start/End: Original strand, 9854 - 9950
Alignment:
8 gattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtga 104  Q
    |||||||||| ||||||||||||||||| ||||||||||||||||||||| ||||| | ||||||| |||||||||||||||||| |||||| ||||    
9854 gattcgatttccagggggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgtccacctttggtgggtcagaaaccagtga 9950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 65; Significance: 2e-28; HSPs: 39)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 13036111 - 13036003
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||| | |||||||||||||||||||||| ||| ||||||||||||||||||||| | ||| ||||||||| ||||||  ||||||||||||||||||    
13036111 aatatcgggttcgattttcagggggaacaacacttggccagtgcgcatgcctctacgcatgagccagattagtcgtccactattggtgggtcggaaaccg 13036012  T
101 gtgagaaag 109  Q
    ||| |||||    
13036011 gtgcgaaag 13036003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 10 - 109
Target Start/End: Original strand, 3601096 - 3601195
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||| |||||||||||||||||| |||||||||||||||| |||  ||||| | ||||||| ||||||||||||||||||||||||||||| |||||    
3601096 ttcgattctcagggggaacaacgcttggccagtgcgcatgcctatacacacgagccggattagtcgtccacctttggtgggtcggaaaccggtgcgaaag 3601195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 25 - 109
Target Start/End: Complemental strand, 9633708 - 9633624
Alignment:
25 gaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||||||| ||||||||||||||||||||| ||||| | ||||||| | ||||||||||||||||||||||||||| |||||    
9633708 gaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 9633624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 1 - 109
Target Start/End: Original strand, 12606433 - 12606541
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||| |||||||||||| |||||||||||||| || ||||||||||||||||||||| ||||| | ||||||| | |||||||||||| |  ||||||||    
12606433 aataccagattcgatttccagggggaacaacgtttggccagtgcgcatgcctctacgcacgagccggattagtcgcccacctttggtgagctggaaaccg 12606532  T
101 gtgagaaag 109  Q
    ||| |||||    
12606533 gtgcgaaag 12606541  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 10 - 98
Target Start/End: Complemental strand, 29444863 - 29444775
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaac 98  Q
    ||||||||  |||||||||||||||| ||||||||||||||||||||| | ||| | ||||||||||||| ||||||||||||||||||    
29444863 ttcgatttctagggggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagttgtccatctttggtgggtcggaaac 29444775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 19 - 109
Target Start/End: Original strand, 19089519 - 19089609
Alignment:
19 cagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||||||||| ||| ||||||| ||||||||||||| ||||| | ||||||| ||| ||||||||||||||||||||||||| |||||    
19089519 cagggggaacaacacttggccagtgagcatgcctctacgcacgagccggattagtcgtctacctttggtgggtcggaaaccggtgcgaaag 19089609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 19 - 109
Target Start/End: Original strand, 31129198 - 31129288
Alignment:
19 cagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||| |||||||| || |||||||||||||||||| | ||| |||||||||||| ||||||||||| |||||||||||||| |||||    
31129198 cagggggagcaacgcttggctagtgcgcatgcctctacgcatgagccagattagttgtgcacctttggtgagtcggaaaccggtgcgaaag 31129288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 10 - 109
Target Start/End: Complemental strand, 5253321 - 5253222
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||  ||||||||||||| ||| ||||||||||||||||||||| | ||| | ||||| | | ||||||||||||||||||||||||||| |||||    
5253321 ttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattaatcgcccacctttggtgggtcggaaaccggtgcgaaag 5253222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 10 - 109
Target Start/End: Complemental strand, 6606195 - 6606096
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||| |||||||||||||| ||| |||||||  |||||||||||| | ||| | ||||||| ||||||| ||||||||||||||||||||| |||||    
6606195 ttcgattctcagggggaacaacacttggccagtgtacatgcctctacgcatgagccggattagtcgtccaccattggtgggtcggaaaccggtgcgaaag 6606096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 10 - 109
Target Start/End: Original strand, 21898660 - 21898759
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||  |||| |||||||||||| ||||||||||||||||||||| | ||| | ||||||| || ||||||| |||||||||||||||||| |||||    
21898660 ttcgattcccaggaggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgttcacctttagtgggtcggaaaccggtgcgaaag 21898759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 38 - 108
Target Start/End: Original strand, 11142643 - 11142713
Alignment:
38 ccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaa 108  Q
    |||||||||||||||||||| | ||||||||||||||||||| ||||||||||||||| ||||||| ||||    
11142643 ccagtgcgcatgcctctacgcatgagtcagattagttgtccaactttggtgggtcggagaccggtgcgaaa 11142713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 1 - 99
Target Start/End: Complemental strand, 34954726 - 34954628
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaacc 99  Q
    |||| ||| ||||||| ||||||||||||||| || |||||||| ||| |||||||| | ||| ||||||||| ||||||||||| |||||||||||||    
34954726 aataccaggttcgattctcagggggaacaacgtttggccagtgcacatacctctacgcatgagccagattagtcgtccacctttgatgggtcggaaacc 34954628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 24 - 109
Target Start/End: Complemental strand, 30788937 - 30788852
Alignment:
24 ggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||||| || ||||||||||||||||||| | ||||| | ||||||| | ||||||||||||||||||||||||||| |||||    
30788937 ggaacaacgtttggccagtgcgcatgcctctaggcacgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 30788852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 25 - 99
Target Start/End: Complemental strand, 2271386 - 2271312
Alignment:
25 gaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaacc 99  Q
    ||||||||||||||||||||||||| ||||||| ||||| | ||||||| ||||||||||| |||||| ||||||    
2271386 gaacaacgcttagccagtgcgcatgtctctacgcacgagccggattagtcgtccacctttgatgggtcagaaacc 2271312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 20 - 109
Target Start/End: Original strand, 13468955 - 13469044
Alignment:
20 agggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||||||||| || | |||||| |||||||||||| ||||| ||||||||| | ||||| ||||||||| ||||||||||| |||||    
13468955 agggggaacaacgattggtcagtgcacatgcctctacgcacgagccagattagtcgcccaccattggtgggttggaaaccggtgcgaaag 13469044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 1 - 72
Target Start/End: Complemental strand, 9366530 - 9366459
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattag 72  Q
    |||||||| ||||||||| |||||||| ||||||| ||||||||||||||||||||| ||||| | ||||||    
9366530 aatatcaggttcgatttttagggggaataacgcttggccagtgcgcatgcctctacgcacgagccggattag 9366459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 22 - 109
Target Start/End: Complemental strand, 10311555 - 10311468
Alignment:
22 ggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||||||||| ||||||||||||| ||||||| |||||| |||||||| |  |||| ||||||||||| |||| |||| |||||    
10311555 ggggaacaacgcttggccagtgcgcatgtctctacgcacgagttagattagtcgctcaccattggtgggtcgaaaactggtgcgaaag 10311468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 19 - 109
Target Start/End: Original strand, 12635835 - 12635925
Alignment:
19 cagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||| |||||||||| || |||||||||||||||||| || || | ||||||| | ||||  ||||||||||||||||||||| |||||    
12635835 caggggaaacaacgcttggctagtgcgcatgcctctacgcacaagccggattagtcgcccactattggtgggtcggaaaccggtgcgaaag 12635925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 1 - 109
Target Start/End: Original strand, 8932664 - 8932772
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||| | |||||||  ||||||||||||| ||| || |||||||||||||||||| | ||| | ||||| |   ||||||||| ||||||||||||||    
8932664 aatatcgggttcgattcccagggggaacaacacttggctagtgcgcatgcctctacgcatgagccggattaatcacccacctttgatgggtcggaaaccg 8932763  T
101 gtgagaaag 109  Q
    ||| |||||    
8932764 gtgcgaaag 8932772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 1 - 109
Target Start/End: Original strand, 8944130 - 8944238
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||| | |||||||  ||||||||||||| ||| || |||||||||||||||||| | ||| | ||||| |   ||||||||| ||||||||||||||    
8944130 aatatcgggttcgattcccagggggaacaacacttggctagtgcgcatgcctctacgcatgagccggattaatcacccacctttgatgggtcggaaaccg 8944229  T
101 gtgagaaag 109  Q
    ||| |||||    
8944230 gtgcgaaag 8944238  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 10 - 109
Target Start/End: Original strand, 5029829 - 5029928
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||| |||||| |||||||| || | ||||||||||||||||||| | ||||  ||||||| | ||| ||||| |||||||||||| |||| |||||    
5029829 ttcgattctcagggagaacaacgtttggtcagtgcgcatgcctctacgcatgagttggattagtcgcccatctttgatgggtcggaaactggtgcgaaag 5029928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 22 - 109
Target Start/End: Complemental strand, 29333225 - 29333138
Alignment:
22 ggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||||||| || ||||||||||||||||||||| | ||| |  || ||| ||||||||||||| |||||| |||||||| |||||    
29333225 ggggaacaacgtttggccagtgcgcatgcctctacgcatgagccgaatcagtcgtccacctttggtaggtcggtaaccggtgcgaaag 29333138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 9 - 99
Target Start/End: Original strand, 8888893 - 8888983
Alignment:
9 attcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaacc 99  Q
    |||||||||| | ||| ||||||| || |||||||||||| |||||||| | ||||| ||||||| ||||||||||| ||| ||| |||||    
8888893 attcgatttttaagggaaacaacgtttggccagtgcgcatacctctacgcatgagtcggattagtcgtccacctttgatggatcgaaaacc 8888983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 1 - 103
Target Start/End: Original strand, 13391290 - 13391391
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||| ||||||||||||||||| ||||| | || ||||||||||||||||||||| ||||| | ||||||| | |||  |||  ||||||| ||||||    
13391290 aatatcggattcgattttcagggg-aacaatgtttggccagtgcgcatgcctctacgcacgagccggattagtcgcccatatttaatgggtcgaaaaccg 13391388  T
101 gtg 103  Q
    |||    
13391389 gtg 13391391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 40 - 109
Target Start/End: Complemental strand, 14783488 - 14783419
Alignment:
40 agtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||| ||||||||||||| | ||| | ||||||| ||||||| ||||||||||||||||||||| |||||    
14783488 agtgtgcatgcctctacgcatgagccggattagtcgtccaccattggtgggtcggaaaccggtgcgaaag 14783419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 10 - 109
Target Start/End: Original strand, 8938723 - 8938822
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||  |||| |||||||| |||  |||||||||| || |||||| | ||| |  |||||| ||||||||||| ||||||||||||||||| |||||    
8938723 ttcgattcccaggaggaacaacacttgaccagtgcgcaagcatctacgcatgagccgaattagtcgtccacctttgatgggtcggaaaccggtgcgaaag 8938822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 10 - 109
Target Start/End: Original strand, 30410457 - 30410556
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||| ||||| |||||||| |||| |||||||||||||||||||| | |||   ||||| | |  || |||||||||||||||||||| || |||||    
30410457 ttcgattctcaggaggaacaacacttaaccagtgcgcatgcctctacgcatgagctggattaatcgctcatctttggtgggtcggaaaccgatgcgaaag 30410556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 1 - 108
Target Start/End: Complemental strand, 32157274 - 32157167
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||||| ||  ||||| || ||||||||| |||  ||||||||||| |||||||| | ||| |||||||||  |||| ||||||||| || |||||||    
32157274 aatatcaggtttaatttttagagggaacaacacttgaccagtgcgcatacctctacgcatgagccagattagtcatccatctttggtggatcagaaaccg 32157175  T
101 gtgagaaa 108  Q
    ||| ||||    
32157174 gtgtgaaa 32157167  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 24 - 109
Target Start/End: Complemental strand, 8612058 - 8611973
Alignment:
24 ggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||||||||  |||||| |||||| |||||| | ||  | ||||||| | |||||||||||||||| |||||||||| |||||    
8612058 ggaacaacgcttgaccagtgtgcatgcttctacgcatgaaccggattagtcgcccacctttggtgggtcagaaaccggtgcgaaag 8611973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 32048454 - 32048506
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctc 53  Q
    ||||||||||||||||||||||| |||||||| || | ||||| |||||||||    
32048454 aatatcagattcgattttcagggagaacaacgtttggtcagtgtgcatgcctc 32048506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 10 - 109
Target Start/End: Complemental strand, 14107456 - 14107357
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||  |||| ||||||||||||  ||||||| |||||||||||| | ||| | ||||||| | |||   || |||||||||||||||||| |||||    
14107456 ttcgattcccaggaggaacaacgcttgaccagtgcacatgcctctacgcatgagccggattagtcgcccattattagtgggtcggaaaccggtgcgaaag 14107357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 10 - 57
Target Start/End: Complemental strand, 33859417 - 33859370
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacg 57  Q
    ||||||||| ||||||||||||| ||  ||||||||||||||||||||    
33859417 ttcgatttttagggggaacaacgtttgcccagtgcgcatgcctctacg 33859370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 37 - 99
Target Start/End: Original strand, 21872942 - 21873004
Alignment:
37 gccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaacc 99  Q
    |||| ||| ||||| | |||||||||||  ||||||| ||||||||||| |||||||||||||    
21872942 gccaatgcacatgcttttacgtacgagttggattagtcgtccacctttgatgggtcggaaacc 21873004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 23 - 109
Target Start/End: Complemental strand, 24671951 - 24671865
Alignment:
23 gggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||||| |||  |||||| ||||||||||||| || || | ||||||| |||| |||||| ||| ||||||| ||||| |||||    
24671951 gggaacaacacttgaccagtgtgcatgcctctacgcacaagccggattagtagtccgcctttgatggttcggaaatcggtgtgaaag 24671865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 22 - 98
Target Start/End: Complemental strand, 3588031 - 3587955
Alignment:
22 ggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaac 98  Q
    |||||||||||||| |||||||| ||| |||||||| | ||  | ||||||| ||| ||||||| ||| ||||||||    
3588031 ggggaacaacgcttggccagtgcacatacctctacgcatgaaccggattagtcgtcaacctttgatggatcggaaac 3587955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #36
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 68 - 108
Target Start/End: Complemental strand, 8149837 - 8149797
Alignment:
68 attagttgtccacctttggtgggtcggaaaccggtgagaaa 108  Q
    |||||| ||||||||||||||||| ||||||||||| ||||    
8149837 attagtcgtccacctttggtgggttggaaaccggtgcgaaa 8149797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #37
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 10 - 102
Target Start/End: Complemental strand, 9179834 - 9179742
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggt 102  Q
    |||||||  ||||||||||||| |||  |||||  |||| |||||||| | |||   ||||||| ||||||||||||||| ||||||| ||||    
9179834 ttcgattcccagggggaacaacacttgaccagtatgcatacctctacgcatgagctggattagtcgtccacctttggtggatcggaaatcggt 9179742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #38
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 1 - 73
Target Start/End: Original strand, 10396477 - 10396548
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagt 73  Q
    |||||||||||||||||| | ||||||||||| || ||||||||||||  ||||| | | ||||| |||||||    
10396477 aatatcagattcgattttta-ggggaacaacgtttggccagtgcgcatatctctatgcatgagtcggattagt 10396548  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #39
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 13 - 101
Target Start/End: Original strand, 33940026 - 33940114
Alignment:
13 gattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccgg 101  Q
    |||| ||||| |||||||  |||| ||| |||||||||||||||  ||||| | ||||||| ||||| |||||  |||||| |||||||    
33940026 gattctcaggaggaacaatacttaaccattgcgcatgcctctacacacgagccggattagtcgtccatctttgacgggtcgaaaaccgg 33940114  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 64; Significance: 8e-28; HSPs: 55)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 10 - 109
Target Start/End: Complemental strand, 17748480 - 17748381
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||  ||||||||||||||||| ||||||||||||||||||||||||||| | ||||||| ||||||||||| |||||||||||||| || |||||    
17748480 ttcgattcccagggggaacaacgcttggccagtgcgcatgcctctacgtacgagccggattagtcgtccacctttgttgggtcggaaaccgatgcgaaag 17748381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 38578974 - 38578866
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||| | |||||||  ||||||||||||||||| ||||||||||||||||||||| | ||| | ||||||| | ||||||||||||||||||||||||    
38578974 aatatcgggttcgattcccagggggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccg 38578875  T
101 gtgagaaag 109  Q
    ||| |||||    
38578874 gtgcgaaag 38578866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 44961745 - 44961637
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||||||||| ||||| |||||| |||| ||||  ||||| |||||| |||||||||||||||||||||||| ||| |||||| ||||||||||||||    
44961745 aatatcagattcaatttttaggggggacaatgcttgaccagtacgcatgtctctacgtacgagtcagattagttatccgcctttgatgggtcggaaaccg 44961646  T
101 gtgagaaag 109  Q
    ||| |||||    
44961645 gtgcgaaag 44961637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 8734793 - 8734685
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||||| ||||||||   |||||||||| |||| | ||||||||||||||| ||| ||||| ||||||||| | ||||||||||||||||||||||||    
8734793 aatatcaggttcgatttcttgggggaacaatgcttgggcagtgcgcatgcctcaacgcacgagccagattagtcgcccacctttggtgggtcggaaaccg 8734694  T
101 gtgagaaag 109  Q
    ||| |||||    
8734693 gtgcgaaag 8734685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 10 - 101
Target Start/End: Original strand, 22973978 - 22974069
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccgg 101  Q
    ||||||| |||||||||||||||||| ||||||| |||||| |||||| | ||| ||||||||| |||||||||||||||||| ||||||||    
22973978 ttcgattctcagggggaacaacgcttggccagtgtgcatgcgtctacgcatgagccagattagtcgtccacctttggtgggtcagaaaccgg 22974069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 10 - 109
Target Start/End: Complemental strand, 5069913 - 5069814
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||| |||| ||||||||||||||| |||| ||||||||||||| || || | ||||||| | |||||||||||||||||||||||| || |||||    
5069913 ttcgatttccaggaggaacaacgcttagctagtgtgcatgcctctacgcacaagccggattagtcgcccacctttggtgggtcggaaaccgatgcgaaag 5069814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 22 - 109
Target Start/End: Original strand, 48804706 - 48804793
Alignment:
22 ggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||||| ||| ||||||||||||||||||||| | ||| | ||||||| ||||||| ||||||||||||||||||||| |||||    
48804706 ggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgtccaccattggtgggtcggaaaccggtgcgaaag 48804793  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 23 - 109
Target Start/End: Original strand, 41945497 - 41945583
Alignment:
23 gggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||| ||||||| ||||||||||||||||||||| ||||| | ||||||| |||||||||||||| |||||||| ||||| |||||    
41945497 gggaataacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgtccacctttggtgagtcggaaatcggtgcgaaag 41945583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 10 - 99
Target Start/End: Original strand, 23658190 - 23658279
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaacc 99  Q
    |||||||| ||||||||||||||||| ||||||| ||||||||||||  ||||| | ||||||| ||||| |||||||||||| ||||||    
23658190 ttcgatttccagggggaacaacgcttggccagtgtgcatgcctctacacacgagccggattagtcgtccatctttggtgggtcagaaacc 23658279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 28396267 - 28396166
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||| | ||| ||| |||||||||||||||||||||  |||||||||||| |||| | ||| | ||||||| ||| ||||||||||||||||||||||    
28396267 aatatcgggttcaattctcagggggaacaacgcttagctggtgcgcatgcctttacgcatgagccggattagtcgtctacctttggtgggtcggaaaccg 28396168  T
101 gt 102  Q
    ||    
28396167 gt 28396166  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 20 - 109
Target Start/End: Original strand, 28744183 - 28744272
Alignment:
20 agggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||||||| |||| |||||| ||||| ||||||| |||||| | ||||||| |||||||||||||||||||||||| |||| |||||    
28744183 agggggaacaatgcttggccagtacgcatacctctacatacgagccggattagtcgtccacctttggtgggtcggaaactggtgcgaaag 28744272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 20 - 93
Target Start/End: Complemental strand, 49142757 - 49142684
Alignment:
20 agggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcg 93  Q
    ||||||||||||||||||||||||| |||||||||||| ||||| | ||||||||| ||||||||| |||||||    
49142757 agggggaacaacgcttagccagtgcacatgcctctacgcacgagccggattagttgcccacctttgatgggtcg 49142684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 19 - 103
Target Start/End: Original strand, 13095878 - 13095962
Alignment:
19 cagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtg 103  Q
    ||||||||||||| ||| ||||||||||||||||||||| | ||| | ||||||| |  ||||||||||||||||||||||||||    
13095878 cagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgctcacctttggtgggtcggaaaccggtg 13095962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 1 - 109
Target Start/End: Original strand, 27028281 - 27028389
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||| ||| |||||||| ||||||||||||| ||| ||||||||||||||||||||  | |||   ||||||| |  |||||||||||||||||||||||    
27028281 aataccaggttcgatttccagggggaacaacacttggccagtgcgcatgcctctacacatgagctggattagtcgctcacctttggtgggtcggaaaccg 27028380  T
101 gtgagaaag 109  Q
    ||| |||||    
27028381 gtgcgaaag 27028389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 10 - 109
Target Start/End: Original strand, 1605952 - 1606051
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||| ||||||||||||||||| |||||||| |||||||||| |   ||| | ||||||| | ||||||||||||| ||||||||||||| |||||    
1605952 ttcgatttccagggggaacaacgcttggccagtgcacatgcctctaggcttgagccggattagtcgcccacctttggtggatcggaaaccggtgcgaaag 1606051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 10 - 109
Target Start/End: Original strand, 34659237 - 34659336
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||| ||| ||||||||||||||  |||||||||||||||||||| ||||| | ||||||| | ||||| |||||| |||| ||||||||| |||||    
34659237 ttcgattctcaaggggaacaacgcttgaccagtgcgcatgcctctacgcacgagccggattagtcgcccaccattggtgtgtcgaaaaccggtgcgaaag 34659336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 10 - 108
Target Start/End: Complemental strand, 26423385 - 26423288
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaa 108  Q
    |||||||  |||||| |||||||||| |||||||| | |||||||||| ||||| ||||||||| || |||||||||| ||||||||||||||| ||||    
26423385 ttcgattcccaggggaaacaacgcttggccagtgcacctgcctctacgcacgagccagattagtcgttcacctttggt-ggtcggaaaccggtgcgaaa 26423288  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 1 - 99
Target Start/End: Complemental strand, 45697296 - 45697199
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaacc 99  Q
    |||||||||||||||| ||||||| |||||| |||   ||||||||||||||||||| | ||||  | ||||| |||||||||||||||||||||||||    
45697296 aatatcagattcgattctcagggg-aacaacacttgatcagtgcgcatgcctctacgcatgagttgggttagtcgtccacctttggtgggtcggaaacc 45697199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 20 - 109
Target Start/End: Original strand, 48551878 - 48551967
Alignment:
20 agggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||| |||||||| || |||| |||||||||||||||||| ||| | ||||||| ||||||||||| ||| ||||||||||||| |||||    
48551878 agggtgaacaacggttggccaatgcgcatgcctctacgtatgagccggattagtcgtccacctttgatggatcggaaaccggtgcgaaag 48551967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 10 - 109
Target Start/End: Complemental strand, 10047974 - 10047875
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcaga-ttagttgtccacctttggtgggtcggaaaccggtgagaaa 108  Q
    |||||||  ||||||||||||| ||| ||||||||||| ||||||||| | ||| |||| ||||| ||||||| ||||||||||||||||||||| ||||    
10047974 ttcgattcccagggggaacaacacttggccagtgcgcaggcctctacgcatgag-cagaattagtcgtccaccattggtgggtcggaaaccggtgcgaaa 10047876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 8 - 108
Target Start/End: Complemental strand, 27875188 - 27875088
Alignment:
8 gattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaa 107  Q
    |||||||||  ||||||||| ||| ||| |||||||| |||||||||||| | |||||  |||||| |||||||||| |||||||| ||||||||| |||    
27875188 gattcgattcccagggggaataacacttggccagtgcacatgcctctacgcatgagtcgcattagtcgtccacctttagtgggtcgaaaaccggtgcgaa 27875089  T
108 a 108  Q
    |    
27875088 a 27875088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 1 - 101
Target Start/End: Original strand, 45447972 - 45448072
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||| ||| |||||||| ||||| ||||||||||| || ||||||||| |||||||  || ||||||||||||   |||||||| |||||||||||||||    
45447972 aataccaggttcgatttccagggagaacaacgcttggctagtgcgcatccctctacacactagtcagattagtcacccacctttagtgggtcggaaaccg 45448071  T
101 g 101  Q
    |    
45448072 g 45448072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 10 - 109
Target Start/End: Original strand, 37514932 - 37515031
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||||||| |||||||||| || | ||||||||||| ||||||| ||||| | ||||| | || |||| || |||||||||||||||||| |||||    
37514932 ttcgattttcagtgggaacaacgtttggtcagtgcgcatgtctctacgcacgagccggattaatcgttcaccattagtgggtcggaaaccggtgtgaaag 37515031  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 22 - 109
Target Start/End: Complemental strand, 43346865 - 43346778
Alignment:
22 ggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||||| ||| ||| ||||||||||||||||||||||| | ||||||| |  || ||||||||||||||||||| ||| |||||    
43346865 ggggaacaacacttggccggtgcgcatgcctctacgtacgagccggattagtcgctcatctttggtgggtcggaaaccagtgcgaaag 43346778  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 10 - 109
Target Start/End: Complemental strand, 43862070 - 43861971
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||  |||||||||||||| || ||||||||||||||||||||| | ||| | |||||||  | |||||||||||| ||| ||||||||| |||||    
43862070 ttcgattcccagggggaacaacgtttggccagtgcgcatgcctctacgcatgagccggattagtcattcacctttggtggatcgaaaaccggtgcgaaag 43861971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 10 - 109
Target Start/End: Original strand, 47341887 - 47341986
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||  ||||||||||||| ||| ||||||||||||||||||||| |||||   |||| || || |||| ||||||||||||||| ||||| |||||    
47341887 ttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcacgagcaggattggtcgttcaccattggtgggtcggaaatcggtgcgaaag 47341986  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 28 - 109
Target Start/End: Complemental strand, 21190860 - 21190779
Alignment:
28 caacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||| || |||||||||||||||||| ||||||||||||||| | ||| |  |||||||||| ||||||||| |||||    
21190860 caacgcttggctagtgcgcatgcctctacgcacgagtcagattagtcgcccatcaatggtgggtcgaaaaccggtgcgaaag 21190779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 24 - 109
Target Start/End: Complemental strand, 22993451 - 22993366
Alignment:
24 ggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||||||| ||||||| ||||||||||||| ||||  | ||||||| |  ||||||||||||||| |||||||||| |||||    
22993451 ggaacaacgcttggccagtgtgcatgcctctacgcacgaaccggattagtcgctcacctttggtgggtcagaaaccggtgcgaaag 22993366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 37 - 109
Target Start/End: Original strand, 3353462 - 3353534
Alignment:
37 gccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||||||||||||||||| ||||| | ||||||| ||||||||||| ||| || |||||||||| |||||    
3353462 gccagtgcgcatgcctctacgcacgagccggattagtcgtccacctttgatggatcagaaaccggtgcgaaag 3353534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 1 - 85
Target Start/End: Original strand, 30827294 - 30827378
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttg 85  Q
    |||| ||| |||||||||||||| ||||||| ||| |||||| |||||||||||||| ||||| | ||||||| ||| |||||||    
30827294 aataccaggttcgattttcagggagaacaacacttggccagtacgcatgcctctacgcacgagccggattagtcgtctacctttg 30827378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 23 - 103
Target Start/End: Original strand, 39420861 - 39420941
Alignment:
23 gggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtg 103  Q
    ||||||||||||| |||||||||| |||||||||| | ||| | ||||||| ||| ||||||| |||| ||||||||||||    
39420861 gggaacaacgcttggccagtgcgcgtgcctctacgcatgagccggattagtcgtctacctttgatgggccggaaaccggtg 39420941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 10 - 109
Target Start/End: Complemental strand, 4706082 - 4705983
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||||| ||||||||||||| ||||||| | ||||||| |||||| |||||   ||||||| ||||||||||||| | ||| |||||| || |||||    
4706082 ttcgatttttagggggaacaacgtttagccattacgcatgcttctacgcacgagctggattagtcgtccacctttggtagatcgaaaaccgatgtgaaag 4705983  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 20 - 103
Target Start/End: Original strand, 18785690 - 18785773
Alignment:
20 agggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtg 103  Q
    |||||||||||| ||| ||||||||||||||||||||| | ||    ||||||| || ||||| ||||||||||||||||||||    
18785690 agggggaacaacacttggccagtgcgcatgcctctacgcatgaactggattagtcgttcacctctggtgggtcggaaaccggtg 18785773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 46 - 109
Target Start/End: Original strand, 32768984 - 32769047
Alignment:
46 catgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||||||| ||||||| ||||||| || |||||||||||| ||||||||||||| |||||    
32768984 catgcctctacgcacgagtcggattagtcgttcacctttggtggatcggaaaccggtgtgaaag 32769047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 22 - 109
Target Start/End: Original strand, 39474963 - 39475050
Alignment:
22 ggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||||||||| | |||||||||| |||||||| | ||| | ||||||| |||||||||| |||||||| ||||| ||| |||||    
39474963 ggggaacaacgcttggtcagtgcgcatacctctacgcatgagccggattagtcgtccacctttagtgggtcgaaaaccagtgcgaaag 39475050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 10 - 103
Target Start/End: Original strand, 1797471 - 1797564
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtg 103  Q
    |||||||  |||||| |||||||||| ||||||||||||| ||||||| ||||| | || |||| ||||| ||||| ||| ||| |||||||||    
1797471 ttcgattcccaggggaaacaacgcttggccagtgcgcatgtctctacgcacgagccggactagtcgtccatctttgatggatcgaaaaccggtg 1797564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 40 - 100
Target Start/End: Complemental strand, 41267992 - 41267932
Alignment:
40 agtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||| ||||||||||||| | |||| |||||||| ||||||||||| ||||||||||||||    
41267992 agtgtgcatgcctctacgcatgagttagattagtcgtccacctttgatgggtcggaaaccg 41267932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 10 - 109
Target Start/End: Complemental strand, 4195300 - 4195201
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||| |||| ||||||||  || || |||||||||||||||||| | ||| | ||||||  ||||||| ||||||||| |||||||| || |||||    
4195300 ttcgatttccaggaggaacaacatttggctagtgcgcatgcctctacgcatgagccggattagccgtccaccattggtgggttggaaaccgatgcgaaag 4195201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #39
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 8 - 103
Target Start/End: Original strand, 16802132 - 16802227
Alignment:
8 gattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtg 103  Q
    ||||||||| | ||| ||||||||| || ||||||||| ||||||||||| ||||| | ||||||| |  |||| ||||||||||| |||| ||||    
16802132 gattcgattcttaggaggaacaacgattggccagtgcgtatgcctctacgcacgagccggattagtcgctcaccattggtgggtcgaaaactggtg 16802227  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #40
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 19 - 102
Target Start/End: Original strand, 21530768 - 21530851
Alignment:
19 cagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggt 102  Q
    ||||||||||||| ||| | |||||| |||||||||||| ||||| |  |||| | |  |||||||||||||||||||||||||    
21530768 cagggggaacaacacttggtcagtgcacatgcctctacgcacgagccgaattaatcgctcacctttggtgggtcggaaaccggt 21530851  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #41
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 10 - 109
Target Start/End: Complemental strand, 36619352 - 36619253
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||  ||||||||||||| |||  |||||| ||||||||||||| | ||| | ||||||| ||||||| ||||||||||  ||||| ||| |||||    
36619352 ttcgattcccagggggaacaacacttgtccagtgtgcatgcctctacgcatgagccggattagtcgtccaccattggtgggtcaaaaaccagtgtgaaag 36619253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #42
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 26 - 109
Target Start/End: Complemental strand, 42210344 - 42210261
Alignment:
26 aacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||| || ||||||||||||||||||||| ||||| | ||||| |   ||||| |||||||||||||||||| || |||||    
42210344 aacaacgtttggccagtgcgcatgcctctacgcacgagccggattaatcacccaccgttggtgggtcggaaaccgatgcgaaag 42210261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #43
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 39 - 109
Target Start/End: Original strand, 3603397 - 3603467
Alignment:
39 cagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||||||||||||||| ||||| | ||||| | || ||| |||||||||||||||| ||||| |||||    
3603397 cagtgcgcatgcctctacgcacgagccggattaatcgttcacttttggtgggtcggaaatcggtgcgaaag 3603467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #44
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 1 - 99
Target Start/End: Complemental strand, 20247277 - 20247179
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaacc 99  Q
    |||| ||| ||||||| ||| |||||||||||||| | |||| | |||| ||||||||||| ||| ||||||| ||||||| ||| | ||| |||||||    
20247277 aataccaggttcgattctcatggggaacaacgcttgggcagtacacatgtctctacgtacgggtcggattagtcgtccaccattgataggttggaaacc 20247179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #45
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 23 - 109
Target Start/End: Complemental strand, 24969411 - 24969325
Alignment:
23 gggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||||| ||| |||||||||| ||||||||||||| |||| ||||| | |  || ||||| ||| ||||||||||||| |||||    
24969411 gggaacaacacttggccagtgcgcgtgcctctacgtacaagtcggattaatcgctcatctttgatggctcggaaaccggtgcgaaag 24969325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #46
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 22 - 100
Target Start/End: Original strand, 42032119 - 42032197
Alignment:
22 ggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    ||||||||||| || |||||||| ||| | |||||| | ||| |  |||||||||||||||||| ||||||||||||||    
42032119 ggggaacaacgtttggccagtgcacatacatctacgcatgagccgaattagttgtccacctttgatgggtcggaaaccg 42032197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #47
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 14 - 103
Target Start/End: Original strand, 14535306 - 14535395
Alignment:
14 attttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtg 103  Q
    |||||||||| ||||||| ||| ||||||| ||||||||||||| |||||   ||||||| | ||||| ||| |||||| ||||| ||||    
14535306 attttcagggagaacaacacttggccagtgtgcatgcctctacgcacgagctggattagtcgcccaccattgatgggtcagaaactggtg 14535395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #48
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 24 - 100
Target Start/End: Complemental strand, 19914787 - 19914711
Alignment:
24 ggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||||||||| |||| |||||||||||||||| | ||| ||||||| | | ||||||||| ||||| | ||||||    
19914787 ggaacaacgcttggccaatgcgcatgcctctacgcatgagccagattaatcgcccacctttgatgggttgtaaaccg 19914711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #49
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 10 - 109
Target Start/End: Original strand, 365151 - 365250
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||  |||| |||||||||||||  ||||||||||||||||||| | ||| | |||||||   |||||  |||||||||| |||||| || |||||    
365151 ttcgattcacaggaggaacaacgcttaatcagtgcgcatgcctctacgcatgagcctgattagtgacccaccagtggtgggtcgaaaaccgatgcgaaag 365250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #50
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 10 - 109
Target Start/End: Original strand, 43925523 - 43925622
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||  ||||||||||||| ||| | ||||||||||||||||||| | |||   ||||||||||  ||||||| ||| || ||||||| || |||||    
43925523 ttcgattcccagggggaacaacacttggtcagtgcgcatgcctctacgcatgagctggattagttgtttacctttgatggatcagaaaccgatgtgaaag 43925622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #51
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 42 - 88
Target Start/End: Complemental strand, 4973176 - 4973130
Alignment:
42 tgcgcatgcctctacgtacgagtcagattagttgtccacctttggtg 88  Q
    |||||||||||||||||||||| | ||||||| ||||| ||||||||    
4973176 tgcgcatgcctctacgtacgagccggattagtcgtccagctttggtg 4973130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #52
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 40 - 109
Target Start/End: Complemental strand, 24983487 - 24983417
Alignment:
40 agtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtc-ggaaaccggtgagaaag 109  Q
    |||||||||||||||||| | ||| | ||||||| ||||||| |||||||||| |||||||| || |||||    
24983487 agtgcgcatgcctctacgcatgagccggattagtcgtccaccattggtgggtctggaaaccgatgcgaaag 24983417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #53
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 37 - 109
Target Start/End: Original strand, 45758325 - 45758395
Alignment:
37 gccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||||||||||||||||  ||||||  ||||| | |  |||||||||||||||||||||| ||| |||||    
45758325 gccagtgcgcatgcctctac--acgagttggattaatcgcacacctttggtgggtcggaaacccgtgcgaaag 45758395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #54
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 1 - 109
Target Start/End: Original strand, 14650319 - 14650427
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||| | |||||||| |||| ||||||| ||||  |||||||  ||||||||||| | ||| | | ||||| |  |||||||||||||| | ||||||    
14650319 aatatcgggttcgatttccaggaggaacaatgcttgaccagtgcatatgcctctacgcatgagccgggttagtcgctcacctttggtgggttgaaaaccg 14650418  T
101 gtgagaaag 109  Q
    ||| |||||    
14650419 gtgcgaaag 14650427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #55
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 23 - 99
Target Start/End: Complemental strand, 48224816 - 48224740
Alignment:
23 gggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaacc 99  Q
    |||||||||||||   |||||||||||  |||||||| |||||| ||||||  | || ||||||||||||| |||||    
48224816 gggaacaacgcttgatcagtgcgcatgtatctacgtatgagtcaaattagtccttcatctttggtgggtcgaaaacc 48224740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0316 (Bit Score: 61; Significance: 5e-26; HSPs: 1)
Name: scaffold0316
Description:

Target: scaffold0316; HSP #1
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 1721 - 1613
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||| ||| |||||||| |||||||||||||| |||||||||||||||||||||||| | ||| || |||||| | ||||||||||||||||| ||||||    
1721 aataccaggttcgatttccagggggaacaacgattagccagtgcgcatgcctctacgcatgagccaaattagtcgcccacctttggtgggtcgaaaaccg 1622  T
101 gtgagaaag 109  Q
    ||| |||||    
1621 gtgcgaaag 1613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 61; Significance: 5e-26; HSPs: 42)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 1 - 109
Target Start/End: Original strand, 43032904 - 43033012
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||| |||||||||  ||||||||||||||||| ||||||||||||||||||||  ||||| | ||||||| | |||||||||||||||| |||||||    
43032904 aatatcggattcgattcccagggggaacaacgcttggccagtgcgcatgcctctacacacgagccggattagtcgcccacctttggtgggtcagaaaccg 43033003  T
101 gtgagaaag 109  Q
    ||| |||||    
43033004 gtgcgaaag 43033012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 3418620 - 3418512
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||| | ||||||||| ||| |||||||| ||| |||||||||||||| |||||| | ||||||||||||| |||||||||| ||||||| |||||||    
3418620 aatatcgggttcgatttttaggaggaacaacacttggccagtgcgcatgcgtctacgcatgagtcagattagtcgtccacctttagtgggtcagaaaccg 3418521  T
101 gtgagaaag 109  Q
    ||| |||||    
3418520 gtgcgaaag 3418512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 22 - 108
Target Start/End: Complemental strand, 4479382 - 4479296
Alignment:
22 ggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaa 108  Q
    |||||||||||||| ||||||||||||||||||||| | |||   ||||||| ||||||||||||||||||||||||||||| ||||    
4479382 ggggaacaacgcttggccagtgcgcatgcctctacgcatgagctggattagtcgtccacctttggtgggtcggaaaccggtgcgaaa 4479296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 22 - 108
Target Start/End: Complemental strand, 15884642 - 15884556
Alignment:
22 ggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaa 108  Q
    |||||||||| ||| || |||||||||||||||||| ||||| | ||||||| | ||||||||||||||||||||||||||| ||||    
15884642 ggggaacaacacttggcaagtgcgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaa 15884556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 1 - 103
Target Start/End: Original strand, 18374013 - 18374115
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||| ||| ||||||| |||||| |||||||||||  |||||||||||||||||||| | ||| | ||||||| ||||| ||||||||||||| ||||||    
18374013 aataccaggttcgattctcagggagaacaacgcttgaccagtgcgcatgcctctacgcatgagccggattagtcgtccaactttggtgggtcgaaaaccg 18374112  T
101 gtg 103  Q
    |||    
18374113 gtg 18374115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 22 - 109
Target Start/End: Original strand, 14846599 - 14846686
Alignment:
22 ggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||||| | || | ||||||||||||||||||| | ||||||||| ||| ||||||||||||||||||||||| ||||| |||||    
14846599 ggggaacaatgattggtcagtgcgcatgcctctacgcatgagtcagataagtcgtccacctttggtgggtcggaaatcggtgcgaaag 14846686  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 10 - 109
Target Start/End: Original strand, 17981453 - 17981552
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||  ||||||||||||| |||  |||||| ||||||||||||| |||||||  |||||||| ||| |||||||| |||||||||||||| |||||    
17981453 ttcgattcccagggggaacaactcttgaccagtgtgcatgcctctacgcacgagtcgaattagttgcccagctttggtgagtcggaaaccggtgcgaaag 17981552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 15 - 109
Target Start/End: Complemental strand, 11298360 - 11298266
Alignment:
15 ttttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||| ||||||||| ||||||||||||||||||||||| | | ||| || |||| | |  |||||||||||||||||||||||||| |||||    
11298360 ttttcagagggaacaacacttagccagtgcgcatgcctctatgcatgagccaaattaatcgctcacctttggtgggtcggaaaccggtgcgaaag 11298266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 24 - 109
Target Start/End: Original strand, 10927632 - 10927717
Alignment:
24 ggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||||||| ||||||||||||||||||||| | ||| | ||||||| || ||||||| ||||||||||||||| || |||||    
10927632 ggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgttcacctttagtgggtcggaaaccgatgcgaaag 10927717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 10 - 109
Target Start/End: Complemental strand, 2467216 - 2467117
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||| ||||||||||||| ||| ||||||||||||| ||||| | | ||| | ||||||| ||||||  |||||| |||||||||||||| |||||    
2467216 ttcgatttccagggggaacaactcttggccagtgcgcatgtctctatgcatgagccggattagtcgtccacaattggtgtgtcggaaaccggtgcgaaag 2467117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 10 - 109
Target Start/End: Original strand, 8141114 - 8141213
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||| |||||| |||||||||| ||||||||||||||||||||| | |||    |||||| |||||| ||||||||||| ||||||| || |||||    
8141114 ttcgatttccaggggaaacaacgcttggccagtgcgcatgcctctacgcatgagctgaattagtcgtccacatttggtgggtcagaaaccgatgcgaaag 8141213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 22 - 109
Target Start/End: Complemental strand, 8997630 - 8997543
Alignment:
22 ggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||||||| || |||||| ||||||||| |||| | ||| ||||||||| || || ||||||||||||||||||||||| |||||    
8997630 ggggaacaacgtttcgccagttcgcatgcctatacgcatgagccagattagtcgttcatctttggtgggtcggaaaccggtgcgaaag 8997543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 10 - 109
Target Start/End: Complemental strand, 14666169 - 14666070
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||  |||||| |||||| ||| ||||||||||||||||||||| || || ||||||||| | ||||  ||||||||||| ||||||||| |||||    
14666169 ttcgattcccaggggaaacaacacttggccagtgcgcatgcctctacgcacaagccagattagtcgcccacagttggtgggtcgaaaaccggtgcgaaag 14666070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 10 - 100
Target Start/End: Complemental strand, 9860093 - 9860003
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||||  ||||||||||||| ||| ||||||| ||||||||||||  | ||| ||||||||| ||||||| ||||||| ||||||||||    
9860093 ttcgattcccagggggaacaacacttggccagtgtgcatgcctctacacatgagccagattagtcgtccaccattggtggatcggaaaccg 9860003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 24 - 109
Target Start/End: Original strand, 2964102 - 2964187
Alignment:
24 ggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||||||| |||| || ||||||||||||| ||||  | ||||||| | |||||||||||||||| |||||||||| |||||    
2964102 ggaacaacgcttggccaatgtgcatgcctctacgcacgaaccggattagtcgcccacctttggtgggtcagaaaccggtgcgaaag 2964187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 18 - 103
Target Start/End: Complemental strand, 13358046 - 13357961
Alignment:
18 tcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtg 103  Q
    ||||||||||||||| || |||| || ||||||||||| | ||||| | ||||||| |||| ||||| ||||||||||||||||||    
13358046 tcagggggaacaacgtttggccaatgtgcatgcctctatgcacgagccggattagtcgtccccctttagtgggtcggaaaccggtg 13357961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 25 - 109
Target Start/End: Original strand, 23895595 - 23895679
Alignment:
25 gaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||||||| |||||||||||| |||||||| |||||   ||||| | ||||||||||| |||||||||||| |||| |||||    
23895595 gaacaacgcttggccagtgcgcatacctctacgcacgagatggattaatcgtccacctttgatgggtcggaaacgggtgcgaaag 23895679  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 1 - 109
Target Start/End: Original strand, 36662408 - 36662515
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||| | ||||||||||||||| |||||  ||||||||||||||||||||||||||| ||  | ||||||| |||||| |||  ||| ||||||||||    
36662408 aatatcgggttcgattttcagggg-aacaatacttagccagtgcgcatgcctctacgtatgaaccggattagtcgtccacttttaatggatcggaaaccg 36662506  T
101 gtgagaaag 109  Q
     || |||||    
36662507 atgcgaaag 36662515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 10 - 109
Target Start/End: Original strand, 6100484 - 6100583
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||  |||| |||||||||||| ||||||||||||||| ||||| | ||| | ||||||| || ||||||| |||||||| |||||| || |||||    
6100484 ttcgattcccaggaggaacaacgcttggccagtgcgcatgccactacgcatgagccggattagtcgttcacctttagtgggtcgaaaaccgctgcgaaag 6100583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 10 - 109
Target Start/End: Complemental strand, 16291301 - 16291202
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||||||||||||||||| ||| |||||| | |||||||||| | | |||   ||||||| |  |||||||||||||||| ||||||||| |||||    
16291301 ttcgattttcagggggaacaacacttggccagtacacatgcctctatgcatgagctggattagtcgctcacctttggtgggtcgaaaaccggtgtgaaag 16291202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 10 - 109
Target Start/End: Original strand, 24837254 - 24837353
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||  ||||| ||||||||||| |||||||  |||||||||| | |||||   ||||||| ||||||||||||||| |||||||| |||| |||||    
24837254 ttcgattcccagggagaacaacgcttggccagtgttcatgcctctaagcacgagcaggattagtcgtccacctttggtggatcggaaactggtgcgaaag 24837353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 10 - 89
Target Start/End: Complemental strand, 33401897 - 33401818
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgg 89  Q
    |||||||||||||||||||||| |||  |||||| ||||||||||||| | ||||| ||||||| | |||||||| ||||    
33401897 ttcgattttcagggggaacaacacttgaccagtgtgcatgcctctacgcatgagtcggattagtcgcccacctttagtgg 33401818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 23 - 109
Target Start/End: Original strand, 583837 - 583923
Alignment:
23 gggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||||||||  |||||||||||||||||||| | ||||| ||||||| | ||||||||| ||| |  |||||||||| |||||    
583837 gggaacaacgcttgaccagtgcgcatgcctctacgcatgagtcggattagtcgcccacctttgatggattagaaaccggtgcgaaag 583923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 20 - 109
Target Start/End: Original strand, 26570946 - 26571035
Alignment:
20 agggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||||||||||| ||||||| | |||| |||||| | ||| | ||||||| ||||||||||| || ||||||||||| || |||||    
26570946 agggggaacaacgcttggccagtgtgtatgcatctacgcatgagccggattagtcgtccacctttgatgagtcggaaaccgatgtgaaag 26571035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 20 - 99
Target Start/End: Original strand, 3567926 - 3568005
Alignment:
20 agggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaacc 99  Q
    |||||||||||| |||  ||||||| ||| |||||||| | ||| || ||||||  ||||||||||||||||||||||||    
3567926 agggggaacaacacttgaccagtgcacatacctctacgcatgagccaaattagtcatccacctttggtgggtcggaaacc 3568005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 10 - 109
Target Start/End: Original strand, 43027317 - 43027416
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||  |||| ||||||||| ||  ||| |||||||||||||||| | ||| | ||||||| ||||| ||||| |||||||||||||| || |||||    
43027317 ttcgattcccaggaggaacaacgattgtccaatgcgcatgcctctacgcatgagccggattagtcgtccatctttgatgggtcggaaaccgatgcgaaag 43027416  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 20 - 103
Target Start/End: Complemental strand, 44893366 - 44893283
Alignment:
20 agggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtg 103  Q
    ||||||||||| |||| ||||||| ||||||||||||| ||||| | ||||| | |  |||| ||| |||||||||||||||||    
44893366 agggggaacaatgcttggccagtgtgcatgcctctacgcacgagccggattaatcgctcacccttgatgggtcggaaaccggtg 44893283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 22 - 109
Target Start/End: Original strand, 45521192 - 45521279
Alignment:
22 ggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||||| |||   ||||||||||||||||||| | ||| | ||||||| |  |||||||| ||||||||||||||||| |||||    
45521192 ggggaacaacacttgatcagtgcgcatgcctctacgcatgagccggattagtcgctcacctttgatgggtcggaaaccggtgcgaaag 45521279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 35496362 - 35496300
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgag 63  Q
    |||||||| ||| |||||||| || |||||| ||| | |||||||||||||||||||||||||    
35496362 aatatcaggttcaattttcagaggaaacaacacttggtcagtgcgcatgcctctacgtacgag 35496300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 10 - 103
Target Start/End: Complemental strand, 68196 - 68103
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtg 103  Q
    ||||||| ||||| ||||||||| || ||||||  |||||||| |||  ||||| | ||||| | || |||||||| |||||||||||||||||    
68196 ttcgattctcaggaggaacaacgtttggccagtatgcatgcctttacacacgagccggattaatcgttcacctttgatgggtcggaaaccggtg 68103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 39 - 108
Target Start/End: Complemental strand, 3379881 - 3379812
Alignment:
39 cagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaa 108  Q
    ||||||||| ||||||| | | ||||| ||||||| |||||| |||||||||||||||| ||||| ||||    
3379881 cagtgcgcacgcctctatgcatgagtcggattagtcgtccacttttggtgggtcggaaatcggtgcgaaa 3379812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 27 - 108
Target Start/End: Complemental strand, 28738232 - 28738151
Alignment:
27 acaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaa 108  Q
    ||||||||||  ||||||||||| || |||| ||||| ||||| ||||| ||||| |||||  |||||||||||||| ||||    
28738232 acaacgcttaatcagtgcgcatgtctttacgcacgagccagatcagttgcccaccattggtatgtcggaaaccggtgcgaaa 28738151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 67 - 103
Target Start/End: Complemental strand, 4772092 - 4772056
Alignment:
67 gattagttgtccacctttggtgggtcggaaaccggtg 103  Q
    ||||||| |||||||||||||||||||||||||||||    
4772092 gattagtcgtccacctttggtgggtcggaaaccggtg 4772056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 42 - 109
Target Start/End: Original strand, 993232 - 993299
Alignment:
42 tgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||| ||||||||| ||||  ||||||| ||||||||||||||| || |||| ||||| |||||    
993232 tgcgcatgtctctacgtatgagttggattagtcgtccacctttggtggttcagaaatcggtgcgaaag 993299  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 15 - 109
Target Start/End: Complemental strand, 22212609 - 22212514
Alignment:
15 ttttcagggggaacaacgcttag-ccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||| |||||||||||| | ||||| ||||||| |||||| ||| | | ||||||| |  |||||||||||| ||| ||||||||| |||||    
22212609 ttttcaggtggaacaacgctttgaccagtacgcatgcttctacgcacgggccggattagtcgctcacctttggtggttcgaaaaccggtgcgaaag 22212514  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 19 - 57
Target Start/End: Complemental strand, 8587028 - 8586990
Alignment:
19 cagggggaacaacgcttagccagtgcgcatgcctctacg 57  Q
    ||||||||||||||||| |||||||||||| ||||||||    
8587028 cagggggaacaacgcttggccagtgcgcatacctctacg 8586990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #37
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 47 - 109
Target Start/End: Original strand, 8817082 - 8817144
Alignment:
47 atgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||||||| ||||||| ||||| ||||| | ||||| || |||||||||||||| |||||    
8817082 atgcctctacgcacgagtcggattacttgtctatctttgatgagtcggaaaccggtgcgaaag 8817144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #38
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 9 - 87
Target Start/End: Original strand, 22958781 - 22958859
Alignment:
9 attcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggt 87  Q
    ||||||||||||| |||||||| |||| | ||||| ||||| ||||| | | ||| | ||||||| |||||||||||||    
22958781 attcgattttcagagggaacaatgcttggtcagtgtgcatgtctctatgcatgagccggattagtcgtccacctttggt 22958859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #39
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 10 - 63
Target Start/End: Complemental strand, 38922512 - 38922459
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgag 63  Q
    |||||||  ||| ||||||||||||| |||||||||||||||| |||| |||||    
38922512 ttcgattcccagagggaacaacgcttggccagtgcgcatgcctttacgcacgag 38922459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #40
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 37 - 73
Target Start/End: Complemental strand, 10698998 - 10698962
Alignment:
37 gccagtgcgcatgcctctacgtacgagtcagattagt 73  Q
    ||||||||||||||||||||||||||||  |||||||    
10698998 gccagtgcgcatgcctctacgtacgagttggattagt 10698962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #41
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 1 - 109
Target Start/End: Original strand, 16893940 - 16894046
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||| | |||||||  ||||||||| ||||||| |||||| | ||||||| |||| | ||| | |||| || | ||||||||||||| ||||||||||    
16893940 aatatcgggttcgattcacagggggaataacgcttggccagtacacatgcctttacgcatgagccggatt-gtcgcccacctttggtgg-tcggaaaccg 16894037  T
101 gtgagaaag 109  Q
    ||| |||||    
16894038 gtgcgaaag 16894046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #42
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 1 - 97
Target Start/End: Complemental strand, 43349423 - 43349327
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaa 97  Q
    |||||| ||||| ||||  |||||||||||||||| |||||||  ||| |||||||  ||||| | ||||||| |  |||| ||| |||||||||||    
43349423 aatatcggattcaatttctagggggaacaacgctttgccagtgttcatacctctactcacgagccggattagtcgctcacccttgatgggtcggaaa 43349327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 61; Significance: 5e-26; HSPs: 68)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 18649460 - 18649352
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||| | ||||||||||||||||||||||||||  |||||||||||||||||||||||||| ||||||| | | |||||||| |||| | ||||||||    
18649460 aatatcgggttcgattttcagggggaacaacgcttgaccagtgcgcatgcctctacgtacgagccagattaatcgcccacctttagtggattggaaaccg 18649361  T
101 gtgagaaag 109  Q
    ||| |||||    
18649360 gtgcgaaag 18649352  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 10 - 109
Target Start/End: Complemental strand, 17642103 - 17642004
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||  ||||||||||||| ||| ||||||||||||||||||||| ||||| | ||||||| |||||||||||||||||||||||| |||| |||||    
17642103 ttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcacgagccggattagtcgtccacctttggtgggtcggaaactggtgcgaaag 17642004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 19 - 109
Target Start/End: Original strand, 8764009 - 8764099
Alignment:
19 cagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||||||||| ||| ||||||||||||||||||||| ||||| | ||||||| ||||||| ||||||||||||||||||||| |||||    
8764009 cagggggaacaacacttggccagtgcgcatgcctctacgcacgagccggattagtcgtccaccgttggtgggtcggaaaccggtgcgaaag 8764099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 10 - 102
Target Start/End: Original strand, 2567285 - 2567377
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggt 102  Q
    |||||||||| |||  |||||||||| ||||||||||||||||||||  ||||||||||||||  ||||| ||||||||||||||||||||||    
2567285 ttcgattttcggggaaaacaacgcttggccagtgcgcatgcctctactcacgagtcagattagccgtccatctttggtgggtcggaaaccggt 2567377  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 19 - 109
Target Start/End: Complemental strand, 43959911 - 43959821
Alignment:
19 cagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||||||||||||| ||||||||||||||||||||| ||||| | ||||||| | |||||||| |||| ||||||||||||| |||||    
43959911 cagggggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagtcgcccacctttagtggatcggaaaccggtgcgaaag 43959821  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 10 - 99
Target Start/End: Complemental strand, 14254367 - 14254278
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaacc 99  Q
    |||||||||||||||||||||||||| |||||| ||||||||| |||| | ||| | ||||||| ||||||||||| |||||||||||||    
14254367 ttcgattttcagggggaacaacgcttggccagtacgcatgcctttacgcatgagccggattagtcgtccacctttgatgggtcggaaacc 14254278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 1 - 100
Target Start/End: Original strand, 15465965 - 15466064
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||| ||| |||||||| ||||||||||||||||| | |||||| |||||||||||| ||||||| |||| || |  |||||||||||||||||||||||    
15465965 aataccaggttcgatttccagggggaacaacgcttggtcagtgcacatgcctctacgcacgagtctgattggtcgctcacctttggtgggtcggaaaccg 15466064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 23 - 109
Target Start/End: Original strand, 34719798 - 34719884
Alignment:
23 gggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||| |||||||  |||||||||||||||||||| ||||||||||||||| |  ||||||||||||||||||||| |||| |||||    
34719798 gggaataacgcttgaccagtgcgcatgcctctacgcacgagtcagattagtcgctcacctttggtgggtcggaaactggtgcgaaag 34719884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 20 - 97
Target Start/End: Complemental strand, 12036833 - 12036756
Alignment:
20 agggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaa 97  Q
    ||||||||||| |||| ||||||||||||||||||||| ||||| ||||||| | ||||||||||||||| |||||||    
12036833 agggggaacaatgcttggccagtgcgcatgcctctacgcacgagccagattaatcgtccacctttggtggatcggaaa 12036756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 37 - 109
Target Start/End: Complemental strand, 4581754 - 4581682
Alignment:
37 gccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||||||||||||||||| ||||| | || |||| ||||||||||||||||||||||||||||| |||||    
4581754 gccagtgcgcatgcctctacgcacgagccggaatagtcgtccacctttggtgggtcggaaaccggtgcgaaag 4581682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 1 - 109
Target Start/End: Original strand, 26325812 - 26325920
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||| | |||||||  ||| ||||||||| ||| | ||||||||||||||||||| | ||| | ||||||| ||||||| ||||||||||||||||||    
26325812 aatatcgggttcgattcccagcgggaacaacacttggtcagtgcgcatgcctctacgcatgagccggattagtcgtccaccattggtgggtcggaaaccg 26325911  T
101 gtgagaaag 109  Q
    ||| |||||    
26325912 gtgcgaaag 26325920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 33004123 - 33004015
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||| |||||||||| |||||| ||||| |||| ||||||||||||||||||||| ||||| | |||||||   |||||  |||||||||| ||||||    
33004123 aatatcggattcgatttccaggggaaacaatgcttggccagtgcgcatgcctctacgcacgagccggattagtcacccaccaatggtgggtcgaaaaccg 33004024  T
101 gtgagaaag 109  Q
    ||| |||||    
33004023 gtgcgaaag 33004015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 21 - 109
Target Start/End: Original strand, 37339840 - 37339928
Alignment:
21 gggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||| ||||||||| ||||||||||||||||| ||| ||||| | ||||||| | ||||||||||||||| ||||||||||| |||||    
37339840 ggggggacaacgcttggccagtgcgcatgcctcaacgcacgagccggattagtcgcccacctttggtgggttggaaaccggtgcgaaag 37339928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 10 - 109
Target Start/End: Original strand, 5855531 - 5855630
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||  |||| |||||||||||| ||||||||||||||||||||| | ||| | ||||||| || ||||||| ||||||||||||||| || |||||    
5855531 ttcgattcccaggaggaacaacgcttggccagtgcgcatgcctctacgcatgaggcggattagtcgttcacctttagtgggtcggaaaccgatgcgaaag 5855630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 1 - 100
Target Start/End: Original strand, 10336516 - 10336615
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||| | ||||||||||||||||||||||||||  |||||||||||||||||||| | ||| | ||||| | ||||||||||| ||| ||| ||||||    
10336516 aatatcgggttcgattttcagggggaacaacgcttgaccagtgcgcatgcctctacgcatgagccggattaatcgtccacctttgatggatcgaaaaccg 10336615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #16
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 10 - 109
Target Start/End: Original strand, 10422797 - 10422896
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||||  ||| |||||||| ||| ||||||||||||||||||||| | ||| | ||||||| |||||||||||||  |||||||||||||| |||||    
10422797 ttcgatttctaggaggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgtccacctttggtaagtcggaaaccggtgcgaaag 10422896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #17
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 22 - 109
Target Start/End: Complemental strand, 11397976 - 11397889
Alignment:
22 ggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||||||| || |||| |||| ||||||||||| | ||||| ||||||| ||||||||||||||||||||||| ||||| |||||    
11397976 ggggaacaacgtttggccaatgcgtatgcctctacgcatgagtcggattagtcgtccacctttggtgggtcggaaatcggtgcgaaag 11397889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #18
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 20 - 99
Target Start/End: Complemental strand, 33418204 - 33418125
Alignment:
20 agggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaacc 99  Q
    |||||| ||||||||| ||||||||||||||||||| | ||||| | ||||||| ||||||||||||| |||||||||||    
33418204 aggggggacaacgcttggccagtgcgcatgcctctatgcacgagccggattagtcgtccacctttggtcggtcggaaacc 33418125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #19
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 10 - 109
Target Start/End: Complemental strand, 41663955 - 41663856
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||  ||||||||||||| ||| | ||||||||||||||||||| | |||   ||||||| ||||||| ||||||||||||||||||||| |||||    
41663955 ttcgattcccagggggaacaacacttggtcagtgcgcatgcctctacgcatgagctggattagtcgtccaccattggtgggtcggaaaccggtgcgaaag 41663856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #20
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 10 - 109
Target Start/End: Complemental strand, 45361981 - 45361882
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||| ||||| |||||||||||| ||||||||||||||| ||||| |  || | ||||||| || ||||||| |||||||||||||||||| |||||    
45361981 ttcgattctcaggaggaacaacgcttggccagtgcgcatgccactacgcataagccggattagtcgttcacctttagtgggtcggaaaccggtgcgaaag 45361882  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #21
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 1 - 103
Target Start/End: Complemental strand, 30927835 - 30927733
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||| | |||||||| ||| ||||||||||||| |||| || ||||||||||||| | ||| | ||||||| |||||| ||||||||||| |||||||    
30927835 aatatcgggttcgatttccagagggaacaacgcttggccaatgtgcatgcctctacgcatgagccggattagtcgtccacttttggtgggtcagaaaccg 30927736  T
101 gtg 103  Q
    |||    
30927735 gtg 30927733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #22
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 10 - 103
Target Start/End: Complemental strand, 17092576 - 17092483
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtg 103  Q
    ||||||||||||||| ||||||| || ||||||| | ||||||||||| ||||| | ||||||| ||||||||||||| | || ||||||||||    
17092576 ttcgattttcaggggaaacaacgattggccagtgtgtatgcctctacgcacgagccggattagtcgtccacctttggtagatcagaaaccggtg 17092483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #23
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 25 - 109
Target Start/End: Complemental strand, 10173055 - 10172971
Alignment:
25 gaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||||||| |||||||| |||||||||||| | ||| | ||||| | | ||||||||||||||||||||||||||| |||||    
10173055 gaacaacgcttggccagtgcccatgcctctacgcatgagccggattactcgcccacctttggtgggtcggaaaccggtgcgaaag 10172971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #24
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 1 - 109
Target Start/End: Original strand, 16263545 - 16263653
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||| ||| |||||||| |||| |||||||||||| ||||||||||||||||||||| |  || | || |||| |||||| |||| ||| ||||||||||    
16263545 aataccaggttcgatttccaggaggaacaacgcttggccagtgcgcatgcctctacgcataagccggaatagtcgtccacttttgatggatcggaaaccg 16263644  T
101 gtgagaaag 109  Q
    ||| |||||    
16263645 gtgcgaaag 16263653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #25
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 10 - 109
Target Start/End: Complemental strand, 2981030 - 2980931
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||  ||| ||||||||| ||| ||||||| ||||||||||||| ||||||| ||||||| |||||  ||| |||||||||||| ||||| |||||    
2981030 ttcgattcccagcgggaacaacacttggccagtgtgcatgcctctacgcacgagtcggattagtcgtccatgtttagtgggtcggaaatcggtgcgaaag 2980931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #26
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 10 - 109
Target Start/End: Original strand, 18915876 - 18915975
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||  ||||||||||||| ||| ||||||| ||||||||||||| ||||| | ||||||| |  |||| ||||||||| ||||||||||| |||||    
18915876 ttcgattcccagggggaacaacacttggccagtgtgcatgcctctacgcacgagccggattagtcgctcaccattggtgggttggaaaccggtgcgaaag 18915975  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #27
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 10 - 109
Target Start/End: Complemental strand, 32142945 - 32142846
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||||||||||||||||| ||| |||||||||||||||| |||| | ||| |  |||||| |  |||||||| |||||||||||||| || |||||    
32142945 ttcgattttcagggggaacaacacttggccagtgcgcatgcctttacgcatgagccgaattagtcgctcacctttgatgggtcggaaaccgatgcgaaag 32142846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #28
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 10 - 109
Target Start/End: Complemental strand, 35211271 - 35211172
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||| |||  ||||||| ||||||||| | |||||||||||||| | |||    |||||| ||||||||||||||||||||||||||||| |||||    
35211271 ttcgatttccagaaggaacaatgcttagccaatacgcatgcctctacgcatgagctgaattagtcgtccacctttggtgggtcggaaaccggtgtgaaag 35211172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #29
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 10 - 109
Target Start/End: Original strand, 49078123 - 49078222
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||  |||||| |||||| ||| ||||||||||||||||||||| | ||| | ||||||| || |||| ||||| ||||||||||||||| |||||    
49078123 ttcgattcccaggggaaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgttcaccattggtaggtcggaaaccggtgcgaaag 49078222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #30
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 10 - 109
Target Start/End: Complemental strand, 50371933 - 50371834
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||||||||  ||||||||||| |||||| ||||||| |||||| || || | ||||||| | ||| ||||||||| ||||||||||||| |||||    
50371933 ttcgattttcaggaagaacaacgcttggccagtacgcatgcttctacgcacaagccggattagtcgcccatctttggtggatcggaaaccggtgcgaaag 50371834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #31
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 1 - 102
Target Start/End: Original strand, 5504031 - 5504132
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||||| ||||||| ||||||  ||||||||||    ||||| |||||||||||| | ||| | ||||||| ||||||||||| ||||||||||||||    
5504031 aatatcaggttcgattctcagggaaaacaacgcttgattagtgcacatgcctctacgcatgagccggattagtcgtccacctttgatgggtcggaaaccg 5504130  T
101 gt 102  Q
    ||    
5504131 gt 5504132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #32
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 15238214 - 15238113
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||| | |||||||  |||||||| |||||||| |||| || ||||||||||||| |||| ||| |||||| |  |||||||||||||| ||||||||    
15238214 aatatcgggttcgattcccagggggagcaacgcttggccaatgagcatgcctctacgcacgaatcatattagtcgctcacctttggtgggttggaaaccg 15238115  T
101 gt 102  Q
    ||    
15238114 gt 15238113  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #33
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 12744631 - 12744575
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacg 57  Q
    |||||||||||||||||||||||||||||||||||  | |||||||||| |||||||    
12744631 aatatcagattcgattttcagggggaacaacgcttgactagtgcgcatgtctctacg 12744575  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #34
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 12755621 - 12755565
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacg 57  Q
    |||||||||||||||||||||||||||||||||||  | |||||||||| |||||||    
12755621 aatatcagattcgattttcagggggaacaacgcttgactagtgcgcatgtctctacg 12755565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #35
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 10 - 102
Target Start/End: Complemental strand, 33498938 - 33498846
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggt 102  Q
    ||||||| ||||| ||| |||||||| ||||||||||||||||||||| | ||| | ||||||| ||||||||||| ||| ||| ||| ||||    
33498938 ttcgattctcaggaggagcaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgtccacctttgatggatcgtaaagcggt 33498846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #36
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 50503469 - 50503361
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||| | |||||||  ||||||||||||| |||  |||||||||||||||||||| ||||| | |||| || | |||||  |||||||||||||||||    
50503469 aatatcgggttcgattcccagggggaacaacacttgaccagtgcgcatgcctctacgcacgagccggatttgtcgcccaccaatggtgggtcggaaaccg 50503370  T
101 gtgagaaag 109  Q
     || |||||    
50503369 atgcgaaag 50503361  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #37
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 22 - 109
Target Start/End: Complemental strand, 9659266 - 9659179
Alignment:
22 ggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||||||| ||  | ||||||||||||| |||| | ||| | ||||||| ||||||||||||||||| ||||||||||| |||||    
9659266 ggggaacaacgtttgactagtgcgcatgcctttacgcatgagccggattagtcgtccacctttggtgggttggaaaccggtgcgaaag 9659179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #38
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 18 - 109
Target Start/End: Original strand, 16956483 - 16956574
Alignment:
18 tcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||| ||||||| ||  |||||||||||||||||||| ||||| | |||||||    |||||||||||||||||||||| ||| |||||    
16956483 tcaggggtaacaacgtttgaccagtgcgcatgcctctacgcacgagccggattagtcactcacctttggtgggtcggaaaccagtgcgaaag 16956574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #39
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 10 - 88
Target Start/End: Original strand, 31152725 - 31152803
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtg 88  Q
    |||||||| | ||||||| ||||||| | |||||||| |||||||||  |||||||| |||||| ||||||||||||||    
31152725 ttcgatttcccgggggaataacgcttggtcagtgcgcgtgcctctacacacgagtcaaattagtcgtccacctttggtg 31152803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #40
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 8 - 103
Target Start/End: Original strand, 35908764 - 35908858
Alignment:
8 gattcgattttcagggggaacaacgcttagc-cagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtg 103  Q
    ||||||||||| |||||||||||| ||| |  ||||||||||||||||||| | ||| | ||||||| ||||||| |  ||||||||||||||||||    
35908764 gattcgatttttagggggaacaacactttggtcagtgcgcatgcctctacgcatgagccggattagtcgtccaccat--gtgggtcggaaaccggtg 35908858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #41
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 40226350 - 40226253
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaac 98  Q
    ||||||| |||||||| |||| || |||||||||| | ||||  ||||||||||||| || ||||||||||||  |||||| || || ||||||||||    
40226350 aatatcatattcgattatcagaggtaacaacgcttggtcagtatgcatgcctctacgcacaagtcagattagtcatccaccattagttggtcggaaac 40226253  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #42
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 8 - 97
Target Start/End: Original strand, 48761183 - 48761272
Alignment:
8 gattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaa 97  Q
    ||||||||||||| | ||||||||| || | |||||  |||||||||||| |||||   ||||||| ||||||||||||| |||||||||    
48761183 gattcgattttcaagaggaacaacgtttggtcagtggacatgcctctacgcacgagctggattagtcgtccacctttggtcggtcggaaa 48761272  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #43
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 22 - 103
Target Start/End: Original strand, 50094925 - 50095006
Alignment:
22 ggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtg 103  Q
    ||||||||||| ||  ||||| ||||||| |||||| | ||||| ||||||| ||||||| || ||||||||||||||||||    
50094925 ggggaacaacgtttgaccagtacgcatgcttctacgcatgagtcggattagtcgtccaccattagtgggtcggaaaccggtg 50095006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #44
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 22 - 102
Target Start/End: Complemental strand, 21849292 - 21849212
Alignment:
22 ggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggt 102  Q
    |||||||||||||| || |||||||||||||||||| ||||| | ||||||| |  |||  ||||||||||| ||||||||    
21849292 ggggaacaacgcttggctagtgcgcatgcctctacgcacgagccggattagtcgctcactattggtgggtcgaaaaccggt 21849212  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #45
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 25 - 109
Target Start/End: Original strand, 44969688 - 44969772
Alignment:
25 gaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||||||| ||||||| ||||||| ||||| | ||| | ||||||| ||||| | ||||||| ||||||||||||| |||||    
44969688 gaacaacgcttggccagtgtgcatgcccctacgcatgagccggattagtcgtccatcattggtggatcggaaaccggtgtgaaag 44969772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #46
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 20 - 103
Target Start/End: Complemental strand, 9853366 - 9853283
Alignment:
20 agggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtg 103  Q
    ||||| ||||||| ||  |||||||||||||||||||  ||||  ||||||| | |||||||||||||||||| |||| |||||    
9853366 aggggaaacaacgttttaccagtgcgcatgcctctacacacgaaccagattaatcgtccacctttggtgggtcagaaatcggtg 9853283  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #47
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 10 - 109
Target Start/End: Original strand, 26660147 - 26660245
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||| || ||||||||||  ||   |||| |||||||||||||| | ||| | ||||||| | ||||||||||||||||||||||||||| |||||    
26660147 ttcgatttccacggggaacaacatttgatcagtacgcatgcctctacgcatgagccggattagtcg-ccacctttggtgggtcggaaaccggtgcgaaag 26660245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #48
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 10 - 100
Target Start/End: Complemental strand, 17358570 - 17358480
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    ||||||| |||||| |||||||||||  ||| ||||||||||| |||| | ||| | |||||||||| || |||| ||||||| |||||||    
17358570 ttcgattctcagggagaacaacgcttgaccaatgcgcatgcctttacgcatgagcccgattagttgttcatctttagtgggtcagaaaccg 17358480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #49
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 20 - 73
Target Start/End: Original strand, 6563460 - 6563513
Alignment:
20 agggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagt 73  Q
    |||||||||||||||| |||||||| |||| ||||||| ||||| |||||||||    
6563460 agggggaacaacgcttggccagtgcacatgtctctacgcacgagccagattagt 6563513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #50
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 8 - 109
Target Start/End: Original strand, 25165408 - 25165508
Alignment:
8 gattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaa 107  Q
    ||||||||| ||||||| |||||| ||  ||||||||||||||||||| | || || | |||||||    ||||||||||||||||| ||||||| ||||    
25165408 gattcgattatcagggg-aacaacactctgccagtgcgcatgcctctaggcacaagccggattagtcactcacctttggtgggtcggtaaccggtaagaa 25165506  T
108 ag 109  Q
    ||    
25165507 ag 25165508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #51
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 20 - 81
Target Start/End: Original strand, 31734307 - 31734368
Alignment:
20 agggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacc 81  Q
    ||||| ||||||| || ||||||||||||||||||||||||||| || |||| | |||||||    
31734307 aggggaaacaacgattggccagtgcgcatgcctctacgtacgagccaaattaatcgtccacc 31734368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #52
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 46 - 103
Target Start/End: Complemental strand, 38859179 - 38859122
Alignment:
46 catgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtg 103  Q
    |||||||||||| ||||||||||||| | | ||||||||| ||||||| |||||||||    
38859179 catgcctctacgcacgagtcagattaatcgcccacctttgatgggtcgaaaaccggtg 38859122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #53
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 10 - 99
Target Start/End: Complemental strand, 40288576 - 40288487
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaacc 99  Q
    |||||||| |||||||||||||| || ||||||  ||||||||||||  ||||| | ||||||| |  || | |||||||||||||||||    
40288576 ttcgatttccagggggaacaacggttggccagtatgcatgcctctacacacgagccggattagtcgctcatccttggtgggtcggaaacc 40288487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #54
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 19 - 99
Target Start/End: Original strand, 10507716 - 10507796
Alignment:
19 cagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaacc 99  Q
    |||| ||||||||| || ||||||| |||| |||||||| | ||| | ||||||| |||||||  ||||||||||||||||    
10507716 caggaggaacaacgtttggccagtgtgcatacctctacgcatgagccggattagtcgtccaccactggtgggtcggaaacc 10507796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #55
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 32151030 - 32150922
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||||| |||||||| |||||||||||||  || | |||||||||||||| |||| | ||| |  |||||| |  |||||||| ||||||| ||||||    
32151030 aatatcaggttcgatttccagggggaacaacatttggtcagtgcgcatgcctttacgcatgagccgaattagtcgctcacctttgatgggtcgaaaaccg 32150931  T
101 gtgagaaag 109  Q
     || |||||    
32150930 atgcgaaag 32150922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #56
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 109
Target Start/End: Original strand, 34697335 - 34697443
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||| ||| ||||||| | |||||||||||| ||| || |||| ||||||||||||| | ||| | ||||||| | |||| |||| ||||| ||||||||    
34697335 aataccaggttcgattcttagggggaacaacacttggctagtgtgcatgcctctacgcatgagccggattagtcgcccacttttgatgggttggaaaccg 34697434  T
101 gtgagaaag 109  Q
     || |||||    
34697435 atgcgaaag 34697443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #57
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 42710246 - 42710190
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacg 57  Q
    |||||| | ||||||||||||||| |||||  ||| |||||||||||||||||||||    
42710246 aatatcgggttcgattttcaggggaaacaatacttggccagtgcgcatgcctctacg 42710190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #58
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 48798178 - 48798122
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacg 57  Q
    |||||| | |||||||| |||||||||||||||||  | ||||||||||||||||||    
48798178 aatatcgggttcgatttccagggggaacaacgcttgactagtgcgcatgcctctacg 48798122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #59
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 23 - 102
Target Start/End: Complemental strand, 16150768 - 16150689
Alignment:
23 gggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggt 102  Q
    |||||||||| || |||| |||||||| || ||||||| |||||||||| | ||||||||||| | ||| ||||| ||||    
16150768 gggaacaacgtttggccaatgcgcatgtctttacgtacaagtcagattaatcgtccacctttgataggttggaaatcggt 16150689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #60
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 67 - 109
Target Start/End: Original strand, 51437523 - 51437565
Alignment:
67 gattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||  |||||||||||||||||||||||||||| |||||    
51437523 gattagtcatccacctttggtgggtcggaaaccggtgcgaaag 51437565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #61
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 40 - 109
Target Start/End: Original strand, 6899597 - 6899666
Alignment:
40 agtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||||||||| |||| || || | ||||||| | ||||||||| ||| ||||||||||||| |||||    
6899597 agtgcgcatgcctttacgcacaagccggattagtcgcccacctttgatggatcggaaaccggtgcgaaag 6899666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #62
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 23 - 100
Target Start/End: Complemental strand, 25178662 - 25178585
Alignment:
23 gggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    ||||| ||||||| |||||||||||| |||||||  || || | ||||||| || ||||||| |||||||| ||||||    
25178662 gggaataacgcttggccagtgcgcatacctctacagacaagccggattagtcgttcacctttagtgggtcgaaaaccg 25178585  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #63
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 39 - 108
Target Start/End: Complemental strand, 30044570 - 30044501
Alignment:
39 cagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaa 108  Q
    |||| ||||||| | |||||||||||| ||||||| |||||||   ||||||||| ||||||||| ||||    
30044570 cagtacgcatgcttttacgtacgagtcggattagtcgtccaccaaaggtgggtcgaaaaccggtgcgaaa 30044501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #64
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 10 - 103
Target Start/End: Complemental strand, 31576646 - 31576553
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtg 103  Q
    ||||||| ||||||| ||||| |||| |||| ||||  |||||||||| | ||| | | ||||| ||||| ||||| || ||||||||||||||    
31576646 ttcgattctcaggggaaacaatgcttggccaatgcgtgtgcctctacgcatgagccggcttagtcgtccatctttgatgtgtcggaaaccggtg 31576553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #65
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 1 - 109
Target Start/End: Original strand, 14357755 - 14357863
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||||| |||||||| ||   | ||||||| ||  |||||||||||||||||||| ||||  | ||||| | ||  ||| ||| ||||||||||||||    
14357755 aatatcaggttcgatttccaattgaaacaacgtttgaccagtgcgcatgcctctacgcacgaaccggattaatcgtttaccattgatgggtcggaaaccg 14357854  T
101 gtgagaaag 109  Q
    ||| |||||    
14357855 gtgcgaaag 14357863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #66
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 1 - 109
Target Start/End: Original strand, 17389772 - 17389879
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||| |||||||||||| |||||||||| | ||  |||||||||||||||| ||| | |||   ||||||| |||||    || ||||||||||||||    
17389772 aatatcggattcgattttc-gggggaacaatgtttgaccagtgcgcatgcctccacgcatgagctggattagtcgtccattgctgatgggtcggaaaccg 17389870  T
101 gtgagaaag 109  Q
    ||| |||||    
17389871 gtgcgaaag 17389879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #67
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 1 - 109
Target Start/End: Original strand, 18808265 - 18808373
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||| ||| ||| ||| |||| |||||||||||||  ||||||||||||||| || ||| ||| | ||||| | | | | ||||  ||||||||||||||    
18808265 aataacaggttcaattctcagagggaacaacgcttgaccagtgcgcatgcctttatgtatgagccggattattcgactaactttattgggtcggaaaccg 18808364  T
101 gtgagaaag 109  Q
    ||| |||||    
18808365 gtgcgaaag 18808373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #68
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 10 - 98
Target Start/End: Complemental strand, 41696697 - 41696609
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaac 98  Q
    |||||||| ||||||||  ||| |||  |||||| | ||||||||||| |||| |||||||||| |  |||||||| ||| ||||||||    
41696697 ttcgatttccagggggattaacacttgaccagtgtgtatgcctctacgcacgaatcagattagtcgctcacctttgatggatcggaaac 41696609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 60; Significance: 2e-25; HSPs: 72)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 10 - 109
Target Start/End: Complemental strand, 5732018 - 5731919
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||  |||| |||||||||||| ||||||||||||||||||||||| ||| ||||||||| || ||||||| |||||||||||||||||| |||||    
5732018 ttcgattcccaggaggaacaacgcttggccagtgcgcatgcctctacgtatgagccagattagtcgttcacctttagtgggtcggaaaccggtgcgaaag 5731919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 10 - 109
Target Start/End: Original strand, 9805013 - 9805112
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||  ||||||||||||||||| ||||||||||||||||||||| | ||| | ||||||| |||||||||||||||||||||||| |||| |||||    
9805013 ttcgattcccagggggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgtccacctttggtgggtcggaaacaggtgcgaaag 9805112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 10 - 109
Target Start/End: Original strand, 42086336 - 42086435
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||  |||||||||||||||||  |||||||||||||||||||| | ||| | ||||||| ||||||||||||||||||||||||||||| |||||    
42086336 ttcgattcccagggggaacaacgcttgaccagtgcgcatgcctctacgcatgagccggattagtcgtccacctttggtgggtcggaaaccggtgcgaaag 42086435  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 20 - 109
Target Start/End: Original strand, 8513538 - 8513627
Alignment:
20 agggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||| ||||| |||| |||||||| |||||||||||| ||||| ||||||||| ||||||||||||||||||||||||||||| |||||    
8513538 aggggaaacaatgcttggccagtgcacatgcctctacgcacgagccagattagtcgtccacctttggtgggtcggaaaccggtgcgaaag 8513627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 10 - 109
Target Start/End: Original strand, 12081917 - 12082016
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||| |||||||||||||||||| |||||||||||||| |||||| ||||| |  |||||| |||||||||||||| |||||||| ||||| |||||    
12081917 ttcgattctcagggggaacaacgcttggccagtgcgcatgcatctacgcacgagccgaattagtcgtccacctttggtgagtcggaaatcggtgtgaaag 12082016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 22 - 109
Target Start/End: Complemental strand, 38897805 - 38897718
Alignment:
22 ggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||||||||| ||||||||||||||||||||| ||||| | ||||||||| ||||||||||||| ||||||||| ||| |||||    
38897805 ggggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattagttgcccacctttggtggatcggaaaccagtgcgaaag 38897718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 15 - 109
Target Start/End: Original strand, 43399142 - 43399236
Alignment:
15 ttttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||||||||| ||||||| ||||||||||||||||||||| |||||   ||||||| |||||| |||||| ||||||||||||||| |||||    
43399142 ttttcagggggaataacgcttggccagtgcgcatgcctctacgcacgagcaggattagtcgtccacatttggttggtcggaaaccggtgcgaaag 43399236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 8 - 109
Target Start/End: Original strand, 13664267 - 13664368
Alignment:
8 gattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaa 107  Q
    ||||||||| |||||||||||||| ||| ||||||||||||||||||||| | ||| ||||||| | |  ||||||||||| |||||||||||||| |||    
13664267 gattcgattatcagggggaacaacacttggccagtgcgcatgcctctacgcatgagccagattaatcgatcacctttggtgtgtcggaaaccggtgcgaa 13664366  T
108 ag 109  Q
    ||    
13664367 ag 13664368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 4016362 - 4016254
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||| | ||||||| |||||||||||||| ||| ||||||||||||||||||||  ||||| | |||||||||  |||| |||||||||||||||||     
4016362 aatatcgggttcgattatcagggggaacaacacttggccagtgcgcatgcctctacacacgagccggattagttgctcaccattggtgggtcggaaacca 4016263  T
101 gtgagaaag 109  Q
    ||| |||||    
4016262 gtgcgaaag 4016254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 13 - 109
Target Start/End: Complemental strand, 20682712 - 20682616
Alignment:
13 gattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||| ||||||||||||||||| ||||||||||||||||||||| ||||| | ||||| | | |||||||| |||||| ||||||||||| |||||    
20682712 gatttccagggggaacaacgcttggccagtgcgcatgcctctacgcacgagccggattaatcgaccacctttagtgggttggaaaccggtgcgaaag 20682616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 9 - 109
Target Start/End: Original strand, 40117423 - 40117523
Alignment:
9 attcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaa 108  Q
    ||||||||| ||||||||||||||||| ||||||||||||||||||||| | ||| | ||||| | || |||||||||||| ||| ||||||||| ||||    
40117423 attcgatttccagggggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattaatcgttcacctttggtggatcgaaaaccggtgcgaaa 40117522  T
109 g 109  Q
    |    
40117523 g 40117523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 10 - 109
Target Start/End: Original strand, 1538440 - 1538539
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||  ||||||||||||| ||| ||||||||||||||||||||| | ||| | ||||| | ||||||| ||||||||||||||||||||| |||||    
1538440 ttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattaatcgtccaccattggtgggtcggaaaccggtgcgaaag 1538539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 10 - 109
Target Start/End: Original strand, 23383666 - 23383765
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||  ||||||||||||||||| |||||||||| |||||||||| | |||   ||||||| |||||||||||||||||||||||| |||| |||||    
23383666 ttcgattcccagggggaacaacgcttggccagtgcgcttgcctctacgcatgagctggattagtcgtccacctttggtgggtcggaaactggtgcgaaag 23383765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 8 - 109
Target Start/End: Original strand, 14728089 - 14728191
Alignment:
8 gattcgattttcaggggga-acaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgaga 106  Q
    ||||||||||||||||||  ||||||||| | ||||||||||||||||||| | ||| | |||||||||  |||||||| ||||||||||||||||| ||    
14728089 gattcgattttcagggggggacaacgcttggtcagtgcgcatgcctctacgcatgagccggattagttgctcacctttgatgggtcggaaaccggtgcga 14728188  T
107 aag 109  Q
    |||    
14728189 aag 14728191  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 19 - 108
Target Start/End: Complemental strand, 42291594 - 42291505
Alignment:
19 cagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaa 108  Q
    ||||| ||||||||||| |||||||| |||||||||||| ||||| | ||||||| ||||||||||| ||| ||||||||||||| ||||    
42291594 cagggtgaacaacgcttggccagtgcacatgcctctacgcacgagccggattagtcgtccacctttgatggatcggaaaccggtgcgaaa 42291505  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 14588724 - 14588616
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||| | ||||||||||||| |||| |||||||  |||||||||||||||||||| | ||| | ||||||| |||||||||||||| | || ||||||    
14588724 aatatcgggttcgattttcaggaggaataacgcttgaccagtgcgcatgcctctacgcatgagccggattagtcgtccacctttggtgagccgaaaaccg 14588625  T
101 gtgagaaag 109  Q
    ||| |||||    
14588624 gtgcgaaag 14588616  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 19 - 103
Target Start/End: Complemental strand, 39099868 - 39099784
Alignment:
19 cagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtg 103  Q
    ||||||||||||| ||| |||||||| |||||||||||| | ||| | ||||||| | |||||||||||||||||||||||||||    
39099868 cagggggaacaacacttggccagtgcacatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccggtg 39099784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 1 - 108
Target Start/End: Original strand, 20525838 - 20525945
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||| | |||||||  |||| |||||||| ||| ||||||||||||||||||||| | ||| | ||||||| ||||||| ||||||| ||||||||||    
20525838 aatatcgggttcgattcccaggtggaacaacacttcgccagtgcgcatgcctctacgcatgagccggattagtcgtccaccattggtggatcggaaaccg 20525937  T
101 gtgagaaa 108  Q
    ||| ||||    
20525938 gtgcgaaa 20525945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 26 - 109
Target Start/End: Original strand, 20692958 - 20693041
Alignment:
26 aacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||||| |||||| | |||||||||  | | || |||||||||||||||||||||||||||||||||||||||| |||||    
20692958 aacaacgcttggccagtacacatgcctctgtgcatgattcagattagttgtccacctttggtgggtcggaaaccggtgcgaaag 20693041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 10 - 109
Target Start/End: Complemental strand, 25417281 - 25417182
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||  ||||||||||||||||| ||||||||||||||||||||| ||||| | |||||||  |  ||| |||||||||| |||||||||| |||||    
25417281 ttcgattcccagggggaacaacgcttggccagtgcgcatgcctctacgaacgagccggattagtcatttaccattggtgggtcagaaaccggtgcgaaag 25417182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 1 - 108
Target Start/End: Original strand, 37263241 - 37263347
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||| | ||||||| ||||||| |||||||||| |||| |||||||||||||||| ||||| | ||||||| ||||||||||  ||| ||||||||||    
37263241 aatatcgggttcgattctcagggg-aacaacgcttggccaatgcgcatgcctctacgcacgagccggattagtcgtccacctttattggatcggaaaccg 37263339  T
101 gtgagaaa 108  Q
    ||| ||||    
37263340 gtgcgaaa 37263347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 25 - 103
Target Start/End: Complemental strand, 3653997 - 3653919
Alignment:
25 gaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtg 103  Q
    |||||||||||  |||||||||||||||||||| ||||| | ||||||| ||||||||||||||| ||| |||||||||    
3653997 gaacaacgcttgaccagtgcgcatgcctctacgcacgaggcggattagtcgtccacctttggtggatcgaaaaccggtg 3653919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 8 - 97
Target Start/End: Original strand, 19839334 - 19839423
Alignment:
8 gattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaa 97  Q
    ||||| ||||||||| ||||||||||||   |||||||||||||||||| |||||||||||||||| | | |||||| ||| ||||||||    
19839334 gattcaattttcaggaggaacaacgcttgatcagtgcgcatgcctctacatacgagtcagattagtcgcctacctttagtgagtcggaaa 19839423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 2 - 103
Target Start/End: Complemental strand, 24463992 - 24463891
Alignment:
2 atatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccgg 101  Q
    ||||||| ||||||||||| || |||||||| || ||||||||||||||||||| | ||||| | ||||||| | ||||||||  ||||||| |||||||    
24463992 atatcaggttcgattttcaaggcgaacaacgattggccagtgcgcatgcctctatgcacgagccggattagtcgcccacctttactgggtcgaaaaccgg 24463893  T
102 tg 103  Q
    ||    
24463892 tg 24463891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 11845908 - 11845800
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||| | ||||||||  ||||||||||||| || ||||||||||||||||||||||| ||| |  |||| | | ||||||||| ||||| ||||||||    
11845908 aatatcgggttcgatttcgagggggaacaacgtttggccagtgcgcatgcctctacgtatgagccgaattaatcgcccacctttgatgggttggaaaccg 11845809  T
101 gtgagaaag 109  Q
    ||| |||||    
11845808 gtgtgaaag 11845800  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 25 - 109
Target Start/End: Original strand, 20255393 - 20255477
Alignment:
25 gaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||| |||  |||||||||||||||||||| | ||||| ||||||| |||||||||||||| ||||||||| |||| |||||    
20255393 gaacaacacttgaccagtgcgcatgcctctacgcatgagtcggattagtcgtccacctttggtgagtcggaaactggtgcgaaag 20255477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 10 - 109
Target Start/End: Original strand, 12766140 - 12766239
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||| | ||| ||||||| |||| ||||||| ||||||||||||| | ||  ||||||||| | |||||||||||||||| |||||||||| |||||    
12766140 ttcgattctgaggaggaacaatgcttggccagtgtgcatgcctctacgcatgaaccagattagtcgcccacctttggtgggtcagaaaccggtgcgaaag 12766239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 19 - 109
Target Start/End: Original strand, 19572742 - 19572832
Alignment:
19 cagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||||||||| ||| ||||||||||||||||||||| | ||| | ||||||| || |||| ||||||||| ||||||| ||| |||||    
19572742 cagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgttcaccattggtgggttggaaaccagtgcgaaag 19572832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 1 - 89
Target Start/End: Original strand, 21149734 - 21149822
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgg 89  Q
    |||| ||| ||||||||||||||||||||||| ||  |||||||||||| ||||||| ||||||  ||||||| | ||||| |||||||    
21149734 aataccaggttcgattttcagggggaacaacgtttgaccagtgcgcatgactctacgcacgagttggattagtcgcccaccattggtgg 21149822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 1 - 97
Target Start/End: Original strand, 24875345 - 24875441
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaa 97  Q
    |||||||| ||||||| | |||| |||||||| ||  |||||||||||| ||||||| ||||| | ||||| | ||||||||||| |||||||||||    
24875345 aatatcaggttcgattcttagggagaacaacgtttgaccagtgcgcatgtctctacgcacgagccggattaatcgtccacctttgatgggtcggaaa 24875441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 1 - 109
Target Start/End: Original strand, 38369700 - 38369807
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||| | ||||||| ||||||| |||||| ||| ||||||||||||||||||||| ||||||| |||||||   ||||||||| |||||  |||| ||    
38369700 aatatcgggttcgattctcagggg-aacaacacttggccagtgcgcatgcctctacgcacgagtcggattagtaacccacctttgatgggttagaaatcg 38369798  T
101 gtgagaaag 109  Q
    ||| |||||    
38369799 gtgcgaaag 38369807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 1 - 109
Target Start/End: Original strand, 41800977 - 41801085
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||| | ||||||| ||| ||||||||||||||  ||| |||||||| ||||||| ||||| | ||||||| || || ||||| ||||||||||| ||    
41800977 aatatcgggttcgattctcaaggggaacaacgcttgaccaatgcgcatgtctctacgcacgagccggattagtcgttcatctttgatgggtcggaaagcg 41801076  T
101 gtgagaaag 109  Q
    ||| |||||    
41801077 gtgtgaaag 41801085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 22 - 109
Target Start/End: Original strand, 2485217 - 2485304
Alignment:
22 ggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||||| ||  ||| ||||||||||||||||||| ||||| ||||||| |  |||||||| |||||||||||||| || |||||    
2485217 ggggaacaaccctgggcctgtgcgcatgcctctacgtatgagtcggattagtcgctcacctttgatgggtcggaaaccgatgcgaaag 2485304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 24 - 103
Target Start/End: Complemental strand, 9168337 - 9168258
Alignment:
24 ggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtg 103  Q
    |||||||||||| |||||||||||| |||||||| | ||| | ||||||| |||||||||| |||||||| ||| |||||    
9168337 ggaacaacgcttggccagtgcgcatacctctacgcatgagccggattagtcgtccacctttagtgggtcgaaaatcggtg 9168258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 9 - 80
Target Start/End: Complemental strand, 35638132 - 35638061
Alignment:
9 attcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccac 80  Q
    |||||||||||||| ||||||||| || | ||||| |||| |||||||| ||||||||||||||| ||||||    
35638132 attcgattttcaggaggaacaacgtttggtcagtgtgcatacctctacgcacgagtcagattagtcgtccac 35638061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 26 - 109
Target Start/End: Complemental strand, 42861300 - 42861217
Alignment:
26 aacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||| ||| ||||||||||||||||||||| | ||| | ||||| | ||||||| ||||||||||||| ||||||| |||||    
42861300 aacaacacttggccagtgcgcatgcctctacgcatgagccggattaatcgtccaccattggtgggtcggagaccggtgcgaaag 42861217  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 43 - 109
Target Start/End: Original strand, 40773315 - 40773381
Alignment:
43 gcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||||||||| |||||||| ||||||| || || |||||||| |||||||||||||| |||||    
40773315 gcgcatgcctctacatacgagtcggattagtcgttcatctttggtgcgtcggaaaccggtgcgaaag 40773381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 24 - 109
Target Start/End: Original strand, 7866604 - 7866689
Alignment:
24 ggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||||||| ||||||| ||||||||||||| ||||  | ||||||| | |||||||||||||||  |||||| ||| |||||    
7866604 ggaacaacgcttggccagtgtgcatgcctctacgcacgaaccggattagtcgcccacctttggtgggttagaaaccagtgcgaaag 7866689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 24 - 109
Target Start/End: Original strand, 9812895 - 9812980
Alignment:
24 ggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||||||| ||||||| |||||| |||||| | ||  | ||||||| | |||||||||||||||| |||||||||| |||||    
9812895 ggaacaacgcttggccagtgtgcatgcttctacgcatgaaccggattagtcgcccacctttggtgggtcagaaaccggtgcgaaag 9812980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 22 - 103
Target Start/End: Original strand, 20590020 - 20590101
Alignment:
22 ggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtg 103  Q
    |||||||||||||| ||||||||||||| ||||||| | ||| |  |||||||||||||  |||| || |||||||||||||    
20590020 ggggaacaacgcttggccagtgcgcatgactctacgcatgagccgtattagttgtccactattggaggatcggaaaccggtg 20590101  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 13 - 109
Target Start/End: Original strand, 5079343 - 5079438
Alignment:
13 gattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||| ||||||||||| ||||| | || ||||||||| |||||| ||||| | ||||||| | ||||||||||| ||||| ||||||||| |||||    
5079343 gatttccagggggaacagcgcttggtcaatgcgcatgcttctacgcacgagccggattagtcgcccacctttggt-ggtcgaaaaccggtgcgaaag 5079438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #42
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 23247458 - 23247351
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||| | |||||||  |||| ||||||||||||   ||||  ||||||||||||| ||||| ||||||||| ||||||||||| | ||||| ||||||    
23247458 aatatcgggttcgattcccaggaggaacaacgcttgatcagtatgcatgcctctacgcacgagccagattagtcgtccacctttgat-ggtcgaaaaccg 23247360  T
101 gtgagaaag 109  Q
    ||| |||||    
23247359 gtgcgaaag 23247351  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #43
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 7 - 63
Target Start/End: Original strand, 25467416 - 25467472
Alignment:
7 agattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgag 63  Q
    |||||||||||||||| ||||||||| || |||||| |||||||||||||| |||||    
25467416 agattcgattttcaggaggaacaacgattggccagtacgcatgcctctacgcacgag 25467472  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #44
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 14 - 109
Target Start/End: Complemental strand, 18262712 - 18262617
Alignment:
14 attttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||||||||||||||||||  ||||||||||| |||||||  ||||| | ||||||| | |||||| || ||| ||| ||| ||||| |||||    
18262712 attttcagggggaacaacgcttgaccagtgcgcatacctctacacacgagccggattagtcgcccacctctgatggatcgaaaatcggtgcgaaag 18262617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #45
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 22 - 109
Target Start/End: Complemental strand, 41163546 - 41163459
Alignment:
22 ggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||||||| || |||||||| |||| ||||||| | |||   ||||||| |||||||||| ||||||||||||| |||| |||||    
41163546 ggggaacaacgtttggccagtgcacatgtctctacgcatgagctggattagtcgtccaccttttgtgggtcggaaactggtgcgaaag 41163459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #46
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 26 - 100
Target Start/End: Original strand, 15034100 - 15034174
Alignment:
26 aacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||| ||| | ||||| ||||||||||||| | ||| | ||||||||||||||||||| ||| ||||||||||    
15034100 aacaacacttggtcagtgtgcatgcctctacgcatgagcctgattagttgtccacctttgatggatcggaaaccg 15034174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #47
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 39 - 97
Target Start/End: Original strand, 24499020 - 24499078
Alignment:
39 cagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaa 97  Q
    ||||||||||||||||||||||||| | ||||| | ||||| ||||||||||| |||||    
24499020 cagtgcgcatgcctctacgtacgagccggattaatagtccatctttggtgggttggaaa 24499078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #48
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 1 - 103
Target Start/End: Original strand, 28862825 - 28862927
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||||| ||||||| ||||| |||||||||||| |||| ||| |||||||||||| ||||     ||||||||  |||| || || ||||||||||||    
28862825 aatatcaggttcgattctcaggcggaacaacgcttggccaatgcacatgcctctacgcacgacctgaattagttgctcaccattagtaggtcggaaaccg 28862924  T
101 gtg 103  Q
    |||    
28862925 gtg 28862927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #49
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 12 - 98
Target Start/End: Original strand, 32874798 - 32874884
Alignment:
12 cgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaac 98  Q
    ||||||||| ||||||||||||||  | ||||||||| ||| |||| ||||| |  |||| | ||||||| ||||||||||||||||    
32874798 cgattttcaaggggaacaacgcttgactagtgcgcatacctttacgcacgagccgaattaatcgtccaccattggtgggtcggaaac 32874884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #50
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 24 - 109
Target Start/End: Original strand, 12705037 - 12705122
Alignment:
24 ggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||||||||  |||||| |||||| |||||| | ||  | ||||||| | |||||||||||||||| |||||||||| |||||    
12705037 ggaacaacgcttgaccagtgtgcatgcttctacgcatgaaccggattagtcgcccacctttggtgggtcagaaaccggtgcgaaag 12705122  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #51
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 10 - 71
Target Start/End: Original strand, 26077150 - 26077211
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagatta 71  Q
    |||||||  ||| ||||||||||||| |||||||| |||||||||||| ||||| |||||||    
26077150 ttcgattcccagagggaacaacgcttggccagtgcacatgcctctacgcacgagccagatta 26077211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #52
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 89
Target Start/End: Complemental strand, 14974431 - 14974343
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgg 89  Q
    |||||| | ||||||| | | ||||||||||  || |||||||| |||||||||||| | ||| | ||||||| |||||||||||||||    
14974431 aatatcgggttcgattctaaaggggaacaacatttggccagtgcacatgcctctacgcatgagccggattagtcgtccacctttggtgg 14974343  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #53
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 20705563 - 20705619
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacg 57  Q
    |||||| ||||| |||||||||| |||||||| || | |||||||||||||||||||    
20705563 aatatcggattcaattttcagggagaacaacgtttggtcagtgcgcatgcctctacg 20705619  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #54
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 10 - 108
Target Start/End: Original strand, 21487626 - 21487721
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaa 108  Q
    ||||||||||||| ||||||||| || || |||||||||||||||    ||||| | ||||||| | ||||||||  ||||||| ||||||||| ||||    
21487626 ttcgattttcaggaggaacaacgtttggctagtgcgcatgcctct---cacgagccggattagtcgcccacctttaatgggtcgaaaaccggtgcgaaa 21487721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #55
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 45 - 109
Target Start/End: Complemental strand, 27648488 - 27648424
Alignment:
45 gcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||||||||||| ||| | ||||||| ||||| ||||||||| |||||||||| || |||||    
27648488 gcatgcctctacgtatgagccggattagtcgtccatctttggtggatcggaaaccgatgcgaaag 27648424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #56
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 73
Target Start/End: Original strand, 30995121 - 30995193
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagt 73  Q
    |||| ||| |||||||  ||||||||||||| ||| ||||| ||||||||||||||| ||||| | |||||||    
30995121 aataccaggttcgattcccagggggaacaacacttggccagggcgcatgcctctacgcacgagccggattagt 30995193  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #57
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 22 - 109
Target Start/End: Original strand, 7616941 - 7617028
Alignment:
22 ggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||||||| ||  |||||  ||||||||||||| | ||||||||||||| |||||   ||||||| |||||||| |||| |||||    
7616941 ggggaacaacgtttgaccagtatgcatgcctctacgcatgagtcagattagtcgtccattattggtggatcggaaactggtgcgaaag 7617028  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #58
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 26 - 109
Target Start/End: Original strand, 20228742 - 20228825
Alignment:
26 aacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||| |||| || |||||| ||||||||||  ||||||||||||||| | ||| ||||||||| || ||||||| || |||||    
20228742 aacaatgcttggctagtgcgtatgcctctacacacgagtcagattagtcgcccatctttggtggatcagaaaccgatgtgaaag 20228825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #59
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 38 - 109
Target Start/End: Original strand, 21375388 - 21375459
Alignment:
38 ccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||||||||| |||||| | ||||| ||||||| ||||| ||||| ||| ||||||||| ||| |||||    
21375388 ccagtgcgcatgcttctacgcatgagtcggattagtcgtccatctttgatggatcggaaaccagtgcgaaag 21375459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #60
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 10 - 109
Target Start/End: Complemental strand, 24653909 - 24653811
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||||||||| ||||||| ||| | |||||||||| |||||||| |  || | ||||| | ||||||| ||||||||||| |||||| || |||||    
24653909 ttcgattttcagggagaacaacacttggtcagtgcgcatacctctacgca-tagccggattaatcgtccaccattggtgggtcgaaaaccgatgcgaaag 24653811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #61
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 10 - 57
Target Start/End: Original strand, 28857137 - 28857184
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacg 57  Q
    |||||||  ||||||||||||| ||| |||||||||||||||||||||    
28857137 ttcgattcccagggggaacaacacttggccagtgcgcatgcctctacg 28857184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #62
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 10 - 49
Target Start/End: Original strand, 40060305 - 40060344
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatg 49  Q
    |||||||||||||||||||||| ||| |||||||||||||    
40060305 ttcgattttcagggggaacaacacttggccagtgcgcatg 40060344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #63
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 11 - 49
Target Start/End: Complemental strand, 20516498 - 20516460
Alignment:
11 tcgattttcagggggaacaacgcttagccagtgcgcatg 49  Q
    |||||||| |||||||||||||||| |||||||||||||    
20516498 tcgatttttagggggaacaacgcttggccagtgcgcatg 20516460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #64
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 39 - 109
Target Start/End: Complemental strand, 22655226 - 22655157
Alignment:
39 cagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||| ||||||||||||| |  |||||||||||| |||||||||| |||||||| ||||| ||| |||||    
22655226 cagtgtgcatgcctctacgcataagtcagattagtcgtccaccttt-gtgggtcgaaaaccagtgcgaaag 22655157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #65
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 23 - 73
Target Start/End: Complemental strand, 35006820 - 35006770
Alignment:
23 gggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagt 73  Q
    ||||||||||||| | ||||| ||||||||||||| ||||| |||||||||    
35006820 gggaacaacgcttggtcagtgtgcatgcctctacgcacgagccagattagt 35006770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #66
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 1 - 103
Target Start/End: Original strand, 39728387 - 39728489
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||| ||| ||||||| |||| || |||||| ||| ||||||| |||||||||||||  ||||||  |||||| |  |||||||| |  |||||||||||    
39728387 aataccaggttcgattatcagaggaaacaacacttggccagtgtgcatgcctctacgctcgagtcgaattagtcgctcacctttgatacgtcggaaaccg 39728486  T
101 gtg 103  Q
    |||    
39728487 gtg 39728489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #67
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 40 - 109
Target Start/End: Complemental strand, 6764525 - 6764456
Alignment:
40 agtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||||||||||||| ||||| | ||||||| | | | ||||| |||||||||||| ||||| ||||    
6764525 agtgcgcatgcctctacgcacgagccggattagtcgcctatctttgttgggtcggaaactggtgaaaaag 6764456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #68
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 102
Target Start/End: Complemental strand, 7308471 - 7308370
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||| | |||||||  ||||||||||||||||| | |||||| |||||||||||| | ||| | ||||||| |  |||||||| ||| ||  ||||||    
7308471 aatatcgggttcgattcccagggggaacaacgcttgggcagtgcacatgcctctacgcatgagccggattagtcgctcacctttgatggatcaaaaaccg 7308372  T
101 gt 102  Q
    ||    
7308371 gt 7308370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #69
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 10 - 50
Target Start/End: Original strand, 1899010 - 1899050
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgc 50  Q
    |||||||  ||||||||||||||||| ||||||||||||||    
1899010 ttcgattcccagggggaacaacgcttggccagtgcgcatgc 1899050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #70
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 25 - 89
Target Start/End: Original strand, 7336644 - 7336708
Alignment:
25 gaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgg 89  Q
    |||||||||||   ||||||||||||||||||| ||||| | ||||| | ||| |||||||||||    
7336644 gaacaacgctttatcagtgcgcatgcctctacgcacgagccggattaatcgtctacctttggtgg 7336708  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #71
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 49 - 109
Target Start/End: Original strand, 28857194 - 28857254
Alignment:
49 gcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||||| | ||| | ||||||| |  |||||||||||||||||||||||||| |||||    
28857194 gcctctacgcatgagccggattagtcgctcacctttggtgggtcggaaaccggtgcgaaag 28857254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #72
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 10 - 62
Target Start/End: Complemental strand, 35403610 - 35403558
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacga 62  Q
    ||||||| | |||||||||||||||| |||| |||||||| ||||||| ||||    
35403610 ttcgattctaagggggaacaacgcttggccaatgcgcatgtctctacgcacga 35403558  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 58; Significance: 3e-24; HSPs: 69)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 8 - 109
Target Start/End: Complemental strand, 3136794 - 3136694
Alignment:
8 gattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaa 107  Q
    ||||||||||||||||| |||||| ||| | ||||||||||||||||||| | ||||| ||||||| ||||||||||||| ||||||||||||||| |||    
3136794 gattcgattttcagggg-aacaacacttgggcagtgcgcatgcctctacgcatgagtcggattagtcgtccacctttggttggtcggaaaccggtgcgaa 3136696  T
108 ag 109  Q
    ||    
3136695 ag 3136694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 4 - 109
Target Start/End: Original strand, 19146963 - 19147068
Alignment:
4 atcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtg 103  Q
    ||||||||||||||||||| |||||||||||| ||||||| | || |||||| | |||||   ||||||| |||||||||||||||||||||||||||||    
19146963 atcagattcgattttcaggaggaacaacgcttggccagtgtgtatccctctatgcacgagctggattagtcgtccacctttggtgggtcggaaaccggtg 19147062  T
104 agaaag 109  Q
     |||||    
19147063 cgaaag 19147068  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 30767355 - 30767258
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaac 98  Q
    |||||| | |||||||| ||||||||||||| ||| ||||||| ||||||||||||| ||||| | ||||||| | ||||||||||||||||||||||    
30767355 aatatcgggttcgatttccagggggaacaacacttggccagtgtgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcggaaac 30767258  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 1 - 109
Target Start/End: Original strand, 31072877 - 31072985
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||| ||| |||||||| ||||||||||||||||| | |||||| |||||||||||| ||||  ||||||| | ||||||||||||| ||| ||||||||    
31072877 aataccaggttcgatttccagggggaacaacgcttggtcagtgcacatgcctctacgcacgacccagattaatcgtccacctttggtaggttggaaaccg 31072976  T
101 gtgagaaag 109  Q
    ||| |||||    
31072977 gtgcgaaag 31072985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 10 - 109
Target Start/End: Complemental strand, 28572310 - 28572211
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||  |||||| |||||||||| ||||||  ||||||||||||| ||||| | ||||||| | ||||||||||||||||||||||||||| |||||    
28572310 ttcgattcccaggggaaacaacgcttggccagtatgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 28572211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 20 - 103
Target Start/End: Complemental strand, 50405692 - 50405609
Alignment:
20 agggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtg 103  Q
    ||||| ||||||||||  |||||||||||||||||||| ||||||| ||||||| | ||||| |||||||||||||||||||||    
50405692 aggggaaacaacgcttgaccagtgcgcatgcctctacgcacgagtcggattagtcgcccaccattggtgggtcggaaaccggtg 50405609  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 1 - 103
Target Start/End: Original strand, 10040556 - 10040657
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||| | ||||||| ||||||| |||||||||| ||||||||||||||||||||| ||||| | || | || ||||||||||||||||| ||||||||    
10040556 aatatcgggttcgattctcagggg-aacaacgcttggccagtgcgcatgcctctacgcacgagccggaatggtcgtccacctttggtgggttggaaaccg 10040654  T
101 gtg 103  Q
    |||    
10040655 gtg 10040657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 20 - 98
Target Start/End: Original strand, 30045839 - 30045917
Alignment:
20 agggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaac 98  Q
    |||||||||||||||| ||||||||||||| ||||||| ||||||| ||||||| ||||||||||| ||||||| ||||    
30045839 agggggaacaacgcttggccagtgcgcatgtctctacgcacgagtctgattagtcgtccacctttgatgggtcgtaaac 30045917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 23 - 108
Target Start/End: Complemental strand, 3507619 - 3507534
Alignment:
23 gggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaa 108  Q
    ||||||||| ||| ||||||||||||||||||||| ||||| | ||||||| |  |||||||||||||||||||||||||| ||||    
3507619 gggaacaacacttggccagtgcgcatgcctctacgcacgagccggattagtcgctcacctttggtgggtcggaaaccggtgcgaaa 3507534  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 24 - 109
Target Start/End: Original strand, 54261248 - 54261333
Alignment:
24 ggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||||||| ||||||||||||||||||||| | ||| | ||||||| || ||||||| |||||||||||||||||| |||||    
54261248 ggaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgttcacctttagtgggtcggaaaccggtgcgaaag 54261333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 1 - 109
Target Start/End: Original strand, 928599 - 928707
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||| ||||||||||| |||||||||||||| |||  |||||||||||||| ||||| ||||| | |||||||  ||||||||||||| |||| ||| ||    
928599 aataccagattcgattctcagggggaacaacacttgaccagtgcgcatgccgctacgcacgagccggattagtcatccacctttggtgagtcgaaaatcg 928698  T
101 gtgagaaag 109  Q
    ||| |||||    
928699 gtgcgaaag 928707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 1 - 109
Target Start/End: Original strand, 29127918 - 29128026
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||| | |||||||| ||||| ||||||| ||| | ||||||||||||||||||| | ||| | ||||||| | ||||||||||||||||||||||||    
29127918 aatatcgggttcgatttccagggagaacaacacttggtcagtgcgcatgcctctacgcatgagccggattagtcgcccacctttggtgggtcggaaaccg 29128017  T
101 gtgagaaag 109  Q
     || |||||    
29128018 atgcgaaag 29128026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 1 - 109
Target Start/End: Original strand, 47219143 - 47219251
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||| ||| |||||||  || ||| |||||||||| || |||||||||||||||||| | ||| | ||||||| ||||||||||| ||||||||||||||    
47219143 aataccaggttcgattcccaagggaaacaacgcttggctagtgcgcatgcctctacgcatgagccggattagtcgtccacctttgatgggtcggaaaccg 47219242  T
101 gtgagaaag 109  Q
    ||| |||||    
47219243 gtgcgaaag 47219251  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 51060389 - 51060281
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||| | ||||||| |||||||||||||| ||| | ||||||||||||||||||| | ||    ||||||| ||||||| ||||||||||||||||||    
51060389 aatatcgggttcgattctcagggggaacaacacttggtcagtgcgcatgcctctacgcatgaactggattagtcgtccaccattggtgggtcggaaaccg 51060290  T
101 gtgagaaag 109  Q
    ||| |||||    
51060289 gtgcgaaag 51060281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 10 - 109
Target Start/End: Original strand, 7650235 - 7650334
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||| ||||||||||||| ||| |||||| || ||| ||||||| ||||| | ||||||| | ||||||||||||||| ||||||||||| |||||    
7650235 ttcgatttccagggggaacaacacttggccagtacgaatgtctctacgcacgagccggattagtcgcccacctttggtgggttggaaaccggtgcgaaag 7650334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 22 - 97
Target Start/End: Original strand, 8164573 - 8164648
Alignment:
22 ggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaa 97  Q
    |||||||||||||| |||||||||||||||| |||| ||||||| ||||||| | ||||||||||||| |||||||    
8164573 ggggaacaacgcttggccagtgcgcatgcctttacgcacgagtcggattagtcgcccacctttggtggatcggaaa 8164648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 8 - 102
Target Start/End: Original strand, 29135919 - 29136013
Alignment:
8 gattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggt 102  Q
    |||||||||  ||||||||||||| ||| ||||||||||||||||||||| | ||| | |||||||  |||||| ||||||||| ||||||||||    
29135919 gattcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcttccaccattggtgggttggaaaccggt 29136013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 10 - 103
Target Start/End: Complemental strand, 24506746 - 24506654
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtg 103  Q
    ||||||||||||||  ||||||||||  ||||||| |||||||||||| | ||||||||||||| |  |||| |||||||||||||||||||||    
24506746 ttcgattttcaggga-aacaacgcttgaccagtgcacatgcctctacgcatgagtcagattagtcgctcaccattggtgggtcggaaaccggtg 24506654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 12 - 109
Target Start/End: Complemental strand, 29762252 - 29762155
Alignment:
12 cgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||| ||||||| |||||| ||| ||||||||||||||||||| | | |||   ||||||| ||||||| ||||||||||||||||||||| |||||    
29762252 cgattctcaggggcaacaacacttggccagtgcgcatgcctctatgcatgagctggattagtcgtccaccattggtgggtcggaaaccggtgcgaaag 29762155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 20 - 109
Target Start/End: Original strand, 48342038 - 48342127
Alignment:
20 agggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||||||||||| || |||||||||||||||||| | ||  ||||||||| ||||| ||||||||| |||||||| |||| |||||    
48342038 agggggaacaacgcttggctagtgcgcatgcctctacgcatgaaccagattagtcgtccatctttggtggatcggaaacaggtgcgaaag 48342127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 13 - 73
Target Start/End: Complemental strand, 11687205 - 11687145
Alignment:
13 gattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagt 73  Q
    |||| ||||||||||||| |||| ||||||||||||||||||||||| |||||||||||||    
11687205 gattctcagggggaacaatgcttggccagtgcgcatgcctctacgtatgagtcagattagt 11687145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 13 - 109
Target Start/End: Original strand, 13893937 - 13894033
Alignment:
13 gattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||| ||||||||||||||||| | || |||||||||||||||  ||||| | ||||||| | ||||||||||||| ||| ||||||||| |||||    
13893937 gatttccagggggaacaacgcttggtcaatgcgcatgcctctacacacgagccggattagtcgcccacctttggtggatcgaaaaccggtgcgaaag 13894033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 1 - 109
Target Start/End: Original strand, 35315955 - 35316063
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||| | |||||||  ||||||||||||| ||| ||||||||||||||||||||| | |||   ||||||| | |||| |||||||||||||||||||    
35315955 aatatcgggttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagctggattagtcgcccacttttggtgggtcggaaaccg 35316054  T
101 gtgagaaag 109  Q
     || |||||    
35316055 atgcgaaag 35316063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 10 - 109
Target Start/End: Original strand, 7328852 - 7328950
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||  ||||||||||||| ||| |||||||||||||||| |||| | ||| | ||||||| | ||||||||||||||||| ||||||||| |||||    
7328852 ttcgattcccagggggaacaacacttggccagtgcgcatgcct-tacgcatgagccggattagtcgcccacctttggtgggtcgaaaaccggtgcgaaag 7328950  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 10 - 109
Target Start/End: Original strand, 15320194 - 15320293
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||||  ||| ||||||| | || ||||||| ||||||||||||| ||||| | ||||||| | |||||||||||||||| |||||||||| |||||    
15320194 ttcgatttcgaggaggaacaatgattggccagtgtgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcagaaaccggtgcgaaag 15320293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 10 - 109
Target Start/End: Original strand, 45877462 - 45877561
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||| |||||| |||||| ||| |||||||| |||||||||||| | ||| | ||||||| || |||| ||| ||||||||||||||||| |||||    
45877462 ttcgatttccaggggaaacaacacttggccagtgcacatgcctctacgcatgagccggattagtcgttcaccattgatgggtcggaaaccggtgcgaaag 45877561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 22 - 109
Target Start/End: Complemental strand, 47749192 - 47749105
Alignment:
22 ggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||||| ||| ||||||||||||||||||||| ||||| |  |||||| | ||||||||||| |||||||||||| || |||||    
47749192 ggggaacaactcttggccagtgcgcatgcctctacgcacgagccgaattagtcgcccacctttggtaggtcggaaaccgatgcgaaag 47749105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 44; E-Value: 7e-16
Query Start/End: Original strand, 38 - 109
Target Start/End: Complemental strand, 49021274 - 49021203
Alignment:
38 ccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||||||||||||||| | ||| | ||||||| ||||||| ||||||||||||||||||||| |||||    
49021274 ccagtgcgcatgcctctacgcatgagccggattagtcgtccaccattggtgggtcggaaaccggtgcgaaag 49021203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 11 - 109
Target Start/End: Original strand, 54237457 - 54237555
Alignment:
11 tcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||||||||| ||||||| ||| | ||||||||||| ||||||| | ||| | ||| ||| ||||||| || |||||||||||||||||| |||||    
54237457 tcgattttcagggagaacaacacttggtcagtgcgcatgtctctacgcatgagccggataagtcgtccaccattagtgggtcggaaaccggtgcgaaag 54237555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 25 - 109
Target Start/End: Complemental strand, 15085029 - 15084945
Alignment:
25 gaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||| || ||||||| |||| ||||||||||||||  |||||||| ||| | ||||||||| ||||||||||||| |||||    
15085029 gaacaacggttggccagtgtgcatacctctacgtacgagctagattagtcgtctatctttggtggatcggaaaccggtgtgaaag 15084945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 1 - 109
Target Start/End: Original strand, 23511566 - 23511674
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||| | |||||||  || ||||| ||||| ||  |||||||||||||||||||| | ||||| ||||| | ||||||||||| ||||||| ||||||    
23511566 aatatcgggttcgattcacaaggggagcaacgtttgaccagtgcgcatgcctctacgcatgagtcggattaatcgtccacctttgatgggtcgaaaaccg 23511665  T
101 gtgagaaag 109  Q
    ||| |||||    
23511666 gtgcgaaag 23511674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 21 - 109
Target Start/End: Original strand, 25294979 - 25295067
Alignment:
21 gggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||| |||||| ||| ||||||||||||||||||| | | ||| | ||||||| ||||||| ||||||||| ||||||||||| |||||    
25294979 ggggaaacaacacttggccagtgcgcatgcctctatgcatgagccggattagtcgtccaccattggtgggttggaaaccggtgcgaaag 25295067  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 26362075 - 26361967
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||||| || ||||  || ||||||||||| || | ||||| ||||||||||||| ||||| | ||||||| |  |||||||| ||||||||||||||    
26362075 aatatcaggtttgattcccaaggggaacaacgtttggtcagtgtgcatgcctctacgcacgagccggattagtcgcacacctttgatgggtcggaaaccg 26361976  T
101 gtgagaaag 109  Q
    ||| |||||    
26361975 gtgtgaaag 26361967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 20 - 100
Target Start/End: Original strand, 49198369 - 49198449
Alignment:
20 agggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||||||||| ||| ||||||||||||||||||||| | ||| | ||||||| ||||||| ||||||| || |||||||    
49198369 agggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgtccaccattggtggatcagaaaccg 49198449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 23 - 103
Target Start/End: Complemental strand, 55069765 - 55069685
Alignment:
23 gggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtg 103  Q
    |||||||||| || |||||||| |||||||||||| ||||| | ||||| | |  ||||||||||||||||||||||||||    
55069765 gggaacaacgtttggccagtgcacatgcctctacgcacgagccggattaatcgctcacctttggtgggtcggaaaccggtg 55069685  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 20 - 103
Target Start/End: Complemental strand, 35923712 - 35923629
Alignment:
20 agggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtg 103  Q
    ||||||||||||| || ||||||||||||||||||| | |||||||  |||||| ||||| ||||| ||| ||| |||||||||    
35923712 agggggaacaacgtttggccagtgcgcatgcctctaagcacgagtcgaattagtcgtccatctttgatggatcgaaaaccggtg 35923629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 22 - 109
Target Start/End: Complemental strand, 41630599 - 41630512
Alignment:
22 ggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||||||||||  |||||||||||||||||||  | ||| | ||||||| | ||||||||||| |||||||||| |||| |||||    
41630599 ggggaacaacgcttgcccagtgcgcatgcctctacacatgagccggattagtcgcccacctttggttggtcggaaactggtgtgaaag 41630512  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 22 - 109
Target Start/End: Original strand, 47471851 - 47471938
Alignment:
22 ggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||||| |||| || ||||||||||| |||||| | ||| |  |||||| |||||||||||||||||||||||||| || |||||    
47471851 ggggaacaatgcttggctagtgcgcatgcttctacgcatgagccgaattagtcgtccacctttggtgggtcggaaaccgatgcgaaag 47471938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 1 - 108
Target Start/End: Complemental strand, 51683062 - 51682955
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||| ||| |||||||  |||||||||||||||||  ||||||||||||||||| |  ||||| | ||||||| | |||||  ||||||||||||||||     
51683062 aataccaggttcgattcccagggggaacaacgcttgaccagtgcgcatgcctctccacacgagccggattagtcgcccaccaatggtgggtcggaaacca 51682963  T
101 gtgagaaa 108  Q
    ||| ||||    
51682962 gtgcgaaa 51682955  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 15 - 93
Target Start/End: Original strand, 7648753 - 7648831
Alignment:
15 ttttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcg 93  Q
    |||||||||||||||||| ||  ||||||||||| |||||||| ||||| | ||||||| | ||||||||| |||||||    
7648753 ttttcagggggaacaacgtttgaccagtgcgcatacctctacgcacgagccggattagtcgcccacctttgttgggtcg 7648831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 10 - 108
Target Start/End: Original strand, 53649735 - 53649833
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaa 108  Q
    ||||||| |||||| ||||||| ||| |||||||||| || ||||||| | ||| | ||||||| || |||||||| ||| ||||||||||||| ||||    
53649735 ttcgattctcagggtgaacaacacttggccagtgcgcctgtctctacgcatgagccggattagtcgttcacctttgatggatcggaaaccggtgcgaaa 53649833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 22 - 103
Target Start/End: Original strand, 33688971 - 33689052
Alignment:
22 ggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtg 103  Q
    |||||| ||| ||| ||||||||||||||||||||| | ||| ||| |||||  |||||| ||||||||| |||||||||||    
33688971 ggggaataacacttggccagtgcgcatgcctctacgcatgagccagtttagtcatccaccattggtgggttggaaaccggtg 33689052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 49543518 - 49543615
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaac 98  Q
    |||||| | ||||||| ||| ||||||||||| || | ||||| ||||||||||||| ||||| |  |||||| | |||||||| |||||||||||||    
49543518 aatatcgggttcgattctcatggggaacaacgtttggtcagtgtgcatgcctctacgcacgagccgaattagtcgcccacctttagtgggtcggaaac 49543615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 38 - 102
Target Start/End: Complemental strand, 43330803 - 43330739
Alignment:
38 ccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggt 102  Q
    |||||||||||||||||||| ||||| | ||||||| | ||||||||||||||||  ||||||||    
43330803 ccagtgcgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcaaaaaccggt 43330739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 10 - 101
Target Start/End: Original strand, 26043820 - 26043911
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccgg 101  Q
    |||||||  ||||| ||||||| ||| ||||||||||||||||||||| | ||| | ||||||| |  ||||||||||| ||| ||||||||    
26043820 ttcgattcccagggagaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgctcacctttggtgagtcagaaaccgg 26043911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 20 - 87
Target Start/End: Complemental strand, 32873638 - 32873571
Alignment:
20 agggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggt 87  Q
    |||| |||||||||||  ||||||| |||||||||||||| ||| ||||||||| | |||||||||||    
32873638 agggagaacaacgcttgaccagtgcacatgcctctacgtatgagccagattagtcgcccacctttggt 32873571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 18 - 109
Target Start/End: Complemental strand, 34374533 - 34374442
Alignment:
18 tcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||| |||||| ||| | ||||||||||||||| ||| |  |||| ||||||| | ||  ||||||||||||||||||||||| |||||    
34374533 tcaggggaaacaacacttggtcagtgcgcatgcctcaacgcataagtcggattagtcgcccttctttggtgggtcggaaaccggtgtgaaag 34374442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 26 - 109
Target Start/End: Complemental strand, 35998654 - 35998571
Alignment:
26 aacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||||||   |||||| |||||||||||| ||||||  ||||| | |||||||||| ||||||| |||||||||| |||||    
35998654 aacaacgcttgatcagtgcacatgcctctacgcacgagttggattaatcgtccacctttagtgggtcagaaaccggtgcgaaag 35998571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #49
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 22 - 109
Target Start/End: Complemental strand, 45450534 - 45450447
Alignment:
22 ggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||||| ||||  |||||||||||||||||||| |  ||  |||||||| ||||||||||| || || ||||||||||| |||||    
45450534 ggggaacaatgcttgaccagtgcgcatgcctctacgcataagctagattagtcgtccacctttgatgagttggaaaccggtgcgaaag 45450447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #50
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 10 - 73
Target Start/End: Original strand, 49082832 - 49082895
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagt 73  Q
    |||||||  ||||| |||||||||||||||||||||||||| |||||  |||| ||||||||||    
49082832 ttcgattcccagggagaacaacgcttagccagtgcgcatgcatctacacacgaatcagattagt 49082895  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #51
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 26 - 100
Target Start/End: Original strand, 4638178 - 4638252
Alignment:
26 aacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    ||||||||||  ||||||||||| |||||||| ||||| | ||||||| | ||||||||  ||||||||||||||    
4638178 aacaacgcttgaccagtgcgcatacctctacgcacgagccggattagtagcccacctttaatgggtcggaaaccg 4638252  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #52
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 10 - 108
Target Start/End: Original strand, 6462420 - 6462518
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaa 108  Q
    |||||||  ||||| ||||||||||| ||||||||||||||||||||| | ||| | ||||||| | |||   || |||||| ||||||||||| ||||    
6462420 ttcgattcacagggagaacaacgcttggccagtgcgcatgcctctacgcatgagccggattagtcgaccattattagtgggttggaaaccggtgcgaaa 6462518  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #53
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 35 - 109
Target Start/End: Original strand, 10043715 - 10043789
Alignment:
35 tagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||| ||||| |||||||||||| ||||| ||||||| | |  |||| ||||||||||||||||||||| |||||    
10043715 tagcaagtgcacatgcctctacgcacgaggcagattaatcgctcaccattggtgggtcggaaaccggtgcgaaag 10043789  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #54
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 45 - 103
Target Start/End: Complemental strand, 50753405 - 50753347
Alignment:
45 gcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtg 103  Q
    ||||||||||||| ||||||| ||||||| || || | |||||||||||||||||||||    
50753405 gcatgcctctacgcacgagtcggattagtcgttcatcattggtgggtcggaaaccggtg 50753347  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #55
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 26 - 103
Target Start/End: Original strand, 8362601 - 8362678
Alignment:
26 aacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtg 103  Q
    ||||||| || |||||| |||||||||||||| | ||| || |||||| |||||||||| |||| || ||||||||||    
8362601 aacaacgtttggccagtccgcatgcctctacgcatgagccaaattagtcgtccacctttagtggatccgaaaccggtg 8362678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #56
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 13 - 62
Target Start/End: Original strand, 10855395 - 10855444
Alignment:
13 gattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacga 62  Q
    ||||| ||||||||||||||||| |||||| |||||||||||||| ||||    
10855395 gatttccagggggaacaacgcttggccagtacgcatgcctctacgcacga 10855444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #57
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 22 - 103
Target Start/End: Complemental strand, 15795581 - 15795500
Alignment:
22 ggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtg 103  Q
    |||||||||||||| | ||||||||||||||||||| |||||    |||||| | |||||  |||||||||| |||||||||    
15795581 ggggaacaacgcttggtcagtgcgcatgcctctacgcacgagctgaattagtcgcccaccaatggtgggtcgaaaaccggtg 15795500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #58
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 109
Target Start/End: Complemental strand, 26923369 - 26923261
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||| ||||||||||| ||||  ||||||| ||   |||||||||||| | |||  ||||||| ||||| |||||||   |||||||||| |||||||    
26923369 aatatcggattcgatttttagggaaaacaacgtttgatcagtgcgcatgcatatacacacgagtcggattaattgtccattattggtgggtcagaaaccg 26923270  T
101 gtgagaaag 109  Q
    ||| |||||    
26923269 gtgcgaaag 26923261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #59
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 53 - 109
Target Start/End: Complemental strand, 36043730 - 36043674
Alignment:
53 ctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||| ||||| | ||||||| | ||||||||||||||||||||||||||| |||||    
36043730 ctacgcacgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 36043674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #60
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 24 - 96
Target Start/End: Complemental strand, 52364885 - 52364813
Alignment:
24 ggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaa 96  Q
    ||||||||||||  |||||||||||||||||||| |||||   ||||| | ||| ||||||| ||||||||||    
52364885 ggaacaacgcttgaccagtgcgcatgcctctacgcacgagctggattaatcgtctacctttgatgggtcggaa 52364813  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #61
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 10 - 109
Target Start/End: Complemental strand, 7310802 - 7310703
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||  ||| ||||||||| |||  || ||| ||||||||||||| ||||| | ||||||| |  || |||||||||||||||||||| || |||||    
7310802 ttcgattcccagtgggaacaacacttgcccggtgtgcatgcctctacgcacgagccggattagtcgctcatctttggtgggtcggaaaccgatgcgaaag 7310703  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #62
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 8 - 99
Target Start/End: Complemental strand, 22405644 - 22405553
Alignment:
8 gattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaacc 99  Q
    ||||| ||| ||||| ||||||||||||| ||| |||| |||||| || | ||||| | ||||| | ||||| |||||||| ||||||||||    
22405644 gattctattctcaggaggaacaacgcttaaccaatgcgaatgcctttatgcacgagccggattaatcgtccatctttggtgcgtcggaaacc 22405553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #63
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 10 - 109
Target Start/End: Complemental strand, 26590365 - 26590266
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||| |||||||||||||||||| | ||||| ||||||||||||  |||||  |||||| | |  |   |||||||| ||||||||||||| |||||    
26590365 ttcgattctcagggggaacaacgcttggtcagtgtgcatgcctctacacacgagctagattaatcgatcgtatttggtggatcggaaaccggtgcgaaag 26590266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #64
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 23 - 98
Target Start/End: Original strand, 33251683 - 33251758
Alignment:
23 gggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaac 98  Q
    |||||||||| || ||||||| ||||||||||||| | ||| | ||||||| |||||| |||| ||||||| ||||    
33251683 gggaacaacgtttggccagtgtgcatgcctctacgcatgagccggattagtcgtccacatttgatgggtcgaaaac 33251758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #65
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 23 - 98
Target Start/End: Complemental strand, 45402437 - 45402362
Alignment:
23 gggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaac 98  Q
    ||||||||| ||  ||| ||||||||||||||||| | ||| | ||||||| || ||||||| |||||||||||||    
45402437 gggaacaacactcggcctgtgcgcatgcctctacgcatgagccggattagtcgttcacctttagtgggtcggaaac 45402362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #66
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 61 - 99
Target Start/End: Original strand, 32522038 - 32522076
Alignment:
61 gagtcagattagttgtccacctttggtgggtcggaaacc 99  Q
    ||||||||||||| ||||||||||| |||||||||||||    
32522038 gagtcagattagtcgtccacctttgatgggtcggaaacc 32522076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #67
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 22 - 103
Target Start/End: Complemental strand, 26207888 - 26207807
Alignment:
22 ggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtg 103  Q
    ||||||||||||||  |||||| ||||||||||||| | ||| | ||||||| | |||   || ||||||||||||||||||    
26207888 ggggaacaacgcttgtccagtgtgcatgcctctacgcatgagccggattagtcggccattattagtgggtcggaaaccggtg 26207807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #68
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 42 - 103
Target Start/End: Original strand, 44064584 - 44064645
Alignment:
42 tgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtg 103  Q
    |||||||||||||||| | ||  | ||||||| |  ||||||||||||||||||||||||||    
44064584 tgcgcatgcctctacgcatgaaccggattagtcgctcacctttggtgggtcggaaaccggtg 44064645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #69
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 67 - 99
Target Start/End: Complemental strand, 8683282 - 8683250
Alignment:
67 gattagttgtccacctttggtgggtcggaaacc 99  Q
    ||||||| |||||||||||||||||||||||||    
8683282 gattagtcgtccacctttggtgggtcggaaacc 8683250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0010 (Bit Score: 56; Significance: 5e-23; HSPs: 2)
Name: scaffold0010
Description:

Target: scaffold0010; HSP #1
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 10 - 109
Target Start/End: Complemental strand, 155809 - 155710
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||  ||||||||||||||||| || |||||||||||||||||| ||||| | ||||||| | |||||||||||||||||||| |||||| |||||    
155809 ttcgattcccagggggaacaacgcttggctagtgcgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcggaagccggtgcgaaag 155710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0010; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 20 - 108
Target Start/End: Complemental strand, 25872 - 25784
Alignment:
20 agggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaa 108  Q
    |||| ||||||||||| ||||||||||||| |||||||   ||  |||||||||   ||||||||  |||||| |||||||||| ||||    
25872 agggagaacaacgcttggccagtgcgcatgactctacgcgtgaaccagattagtcacccacctttactgggtcagaaaccggtgcgaaa 25784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0291 (Bit Score: 52; Significance: 1e-20; HSPs: 1)
Name: scaffold0291
Description:

Target: scaffold0291; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 10 - 109
Target Start/End: Original strand, 6866 - 6965
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||  ||||||||||||| ||| ||||||||||||||||||||| | ||| | ||||||| |  |||||||||||||||||||||||||| |||||    
6866 ttcgattcccagggggaacaacacttggccagtgcgcatgcctctacgcatgagccggattagtcgctcacctttggtgggtcggaaaccggtgcgaaag 6965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0016 (Bit Score: 52; Significance: 1e-20; HSPs: 1)
Name: scaffold0016
Description:

Target: scaffold0016; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 10 - 109
Target Start/End: Complemental strand, 8799 - 8700
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||  ||||||||||||||||| |||||||||| |||||||||| | |||   ||||||| |||||||||||||||||||||||| |||| |||||    
8799 ttcgattcccagggggaacaacgcttggccagtgcgcttgcctctacgcatgagctggattagtcgtccacctttggtgggtcggaaactggtgcgaaag 8700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0024 (Bit Score: 50; Significance: 2e-19; HSPs: 1)
Name: scaffold0024
Description:

Target: scaffold0024; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 10 - 103
Target Start/End: Original strand, 149396 - 149489
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtg 103  Q
    ||||||| ||||||||||||||||||  |||||| |||||||||||||||||||  |||||||| | |||||  ||||||||| ||||||||||    
149396 ttcgattctcagggggaacaacgcttgaccagtgtgcatgcctctacgtacgaggtagattagtcgcccaccaatggtgggtcagaaaccggtg 149489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0086 (Bit Score: 48; Significance: 3e-18; HSPs: 1)
Name: scaffold0086
Description:

Target: scaffold0086; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 10 - 109
Target Start/End: Original strand, 26194 - 26293
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||| ||||||||||||||||| ||||||| ||||||||||||| ||||| | ||||||| ||||||  ||| || |||||||||| ||| |||||    
26194 ttcgatttccagggggaacaacgcttggccagtgtgcatgcctctacgcacgagccggattagtcgtccacaattgatgagtcggaaaccagtgcgaaag 26293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002 (Bit Score: 48; Significance: 3e-18; HSPs: 2)
Name: scaffold0002
Description:

Target: scaffold0002; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 10 - 109
Target Start/End: Original strand, 581 - 680
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||  ||||||||||||| |||   ||||| ||||||||||||||| ||| ||||||||| |  |||||||||||||||||||||||||| |||||    
581 ttcgattcgcagggggaacaacacttgatcagtgtgcatgcctctacgtatgagccagattagtcgctcacctttggtgggtcggaaaccggtgcgaaag 680  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0002; HSP #2
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 20 - 109
Target Start/End: Original strand, 319443 - 319532
Alignment:
20 agggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||||||||||| |||||||||||| |||||| | | |||   ||||||| |||||||||||||||| |||||||||||| |||||    
319443 agggggaacaacgcttggccagtgcgcatccctctatgcatgagctggattagtcgtccacctttggtggggcggaaaccggtgcgaaag 319532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0006 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: scaffold0006
Description:

Target: scaffold0006; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 1 - 103
Target Start/End: Original strand, 68519 - 68618
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||| | |||||||  ||||||||||||||||| |   ||||||||||||||||| ||||| | ||||||| | ||||||||||||||||| ||||||    
68519 aatatcgggttcgattcccagggggaacaacgcttgg---gtgcgcatgcctctacgcacgagccggattagtcgcccacctttggtgggtcgaaaaccg 68615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0384 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 1)
Name: scaffold0384
Description:

Target: scaffold0384; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 10 - 100
Target Start/End: Original strand, 5984 - 6073
Alignment:
10 ttcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||||| |||||||| |||||||| |||||||| |||||||||||| | ||| |  |||||| ||||||| ||||||||||||||||||    
5984 ttcgatttccaggggga-caacgcttggccagtgcacatgcctctacgcatgagacgaattagtcgtccaccattggtgggtcggaaaccg 6073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0376 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: scaffold0376
Description:

Target: scaffold0376; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 24 - 109
Target Start/End: Original strand, 12695 - 12780
Alignment:
24 ggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||||||| ||||||| ||||||||||||| ||||  | ||||||| | ||||||||| |||||| |||||||||| |||||    
12695 ggaacaacgcttggccagtgtgcatgcctctacgcacgaaccggattagtcgcccacctttgatgggtcagaaaccggtgcgaaag 12780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0029 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: scaffold0029
Description:

Target: scaffold0029; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 1 - 102
Target Start/End: Original strand, 41046 - 41147
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||||| | ||||||| ||| |||||||||| ||| | ||||| ||||||||||||| ||||| | ||||||| | ||| |||||||| |||||||||||    
41046 aatatcgggttcgattctcaaggggaacaacacttggtcagtgtgcatgcctctacgcacgagccggattagtcgcccatctttggtgagtcggaaaccg 41145  T
101 gt 102  Q
    ||    
41146 gt 41147  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0009 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 2)
Name: scaffold0009
Description:

Target: scaffold0009; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 20 - 109
Target Start/End: Complemental strand, 42920 - 42831
Alignment:
20 agggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||| |||||| |||| | ||||||||||||||||||  | ||| | ||||||| | ||||||||||||||||||||||||||| |||||    
42920 agggagaacaatgcttggtcagtgcgcatgcctctacacatgagccggattagtcgcccacctttggtgggtcggaaaccggtgcgaaag 42831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0009; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 68 - 108
Target Start/End: Original strand, 9511 - 9551
Alignment:
68 attagttgtccacctttggtgggtcggaaaccggtgagaaa 108  Q
    |||||| |||||||||||||||||| |||||||||| ||||    
9511 attagtcgtccacctttggtgggtcagaaaccggtgcgaaa 9551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0223 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 1)
Name: scaffold0223
Description:

Target: scaffold0223; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 18 - 109
Target Start/End: Original strand, 16898 - 16989
Alignment:
18 tcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||| |||||||||| | ||||||| ||| ||||||| ||||| ||||||||| |  |||||||||||||| |||||||| || |||||    
16898 tcaggggaaacaacgcttggtcagtgcgtatgtctctacgcacgagccagattagtcgctcacctttggtgggttggaaaccgatgcgaaag 16989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0209 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 1)
Name: scaffold0209
Description:

Target: scaffold0209; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 23 - 109
Target Start/End: Original strand, 12597 - 12683
Alignment:
23 gggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||||||||  |||||||||||||||||||| | ||||| ||||||| | ||||||||| ||| |  |||||||||| |||||    
12597 gggaacaacgcttgaccagtgcgcatgcctctacgcatgagtcggattagtcgcccacctttgatggattagaaaccggtgcgaaag 12683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0011 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 2)
Name: scaffold0011
Description:

Target: scaffold0011; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 39 - 109
Target Start/End: Original strand, 224357 - 224427
Alignment:
39 cagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||| ||| |||||||| ||||| | ||||||| ||||| ||||||||||||||||||||||| |||||    
224357 cagtgcacatacctctacgcacgagccggattagtcgtccatctttggtgggtcggaaaccggtgcgaaag 224427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0011; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 39 - 108
Target Start/End: Original strand, 186557 - 186626
Alignment:
39 cagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaa 108  Q
    |||||| |||||||||||| ||||| | ||||||| || || |||| |||||||||||||||||| ||||    
186557 cagtgcacatgcctctacgcacgagccggattagtcgttcatctttagtgggtcggaaaccggtgtgaaa 186626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0041 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: scaffold0041
Description:

Target: scaffold0041; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 13 - 109
Target Start/End: Original strand, 25100 - 25195
Alignment:
13 gattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    |||||||||||| ||||||  || | |||||||||||  |||||| | || |||||||| | ||||||||||||||| ||||||||||||| |||||    
25100 gattttcagggg-aacaacatttggacagtgcgcatgtttctacgcatgaatcagattaatcgtccacctttggtggatcggaaaccggtgcgaaag 25195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005 (Bit Score: 37; Significance: 0.00000000001; HSPs: 3)
Name: scaffold0005
Description:

Target: scaffold0005; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 37 - 109
Target Start/End: Complemental strand, 250096 - 250024
Alignment:
37 gccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||||||||||||||||| ||||| | ||||||| |  | |||||||||||||||||| ||||| |||||    
250096 gccagtgcgcatgcctctacgcacgagccggattagtcgctcgcctttggtgggtcggaaatcggtgcgaaag 250024  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005; HSP #2
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 37 - 103
Target Start/End: Original strand, 219407 - 219473
Alignment:
37 gccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtg 103  Q
    ||||||||||||||||||||| ||||    ||||||| ||||||||||| ||| ||| |||||||||    
219407 gccagtgcgcatgcctctacgcacgaactggattagtcgtccacctttgatggatcgaaaaccggtg 219473  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0005; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 1 - 63
Target Start/End: Complemental strand, 271181 - 271119
Alignment:
1 aatatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgag 63  Q
    |||||| | |||||||  ||||||||||||||||| | ||||||||||| ||||||| |||||    
271181 aatatcgggttcgattcccagggggaacaacgcttggtcagtgcgcatgtctctacgcacgag 271119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0341 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: scaffold0341
Description:

Target: scaffold0341; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 20 - 73
Target Start/End: Original strand, 18653 - 18706
Alignment:
20 agggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagt 73  Q
    |||||||||||||||| |||||||| |||| ||||||| ||||| |||||||||    
18653 agggggaacaacgcttggccagtgcacatgtctctacgcacgagccagattagt 18706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0116 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: scaffold0116
Description:

Target: scaffold0116; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 3 - 100
Target Start/End: Original strand, 17394 - 17491
Alignment:
3 tatcagattcgattttcagggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccg 100  Q
    |||| ||||||||| ||||||| || || ||||  ||||||||||||| |||||  ||||| | ||||||| | ||||| ||| ||||||||||||||    
17394 tatcggattcgattctcaggggaaaaaatgcttgaccagtgcgcatgcttctacacacgagccggattagtcgcccaccattgatgggtcggaaaccg 17491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0079 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0079
Description:

Target: scaffold0079; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 23 - 109
Target Start/End: Original strand, 8198 - 8273
Alignment:
23 gggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggtgagaaag 109  Q
    ||||||||||||| ||||||||||||||||||||           |||||| ||||||||||||| ||||||||||||||| |||||    
8198 gggaacaacgcttggccagtgcgcatgcctctac-----------attagtcgtccacctttggtaggtcggaaaccggtgcgaaag 8273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0004 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0004
Description:

Target: scaffold0004; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 22 - 102
Target Start/End: Complemental strand, 7921 - 7841
Alignment:
22 ggggaacaacgcttagccagtgcgcatgcctctacgtacgagtcagattagttgtccacctttggtgggtcggaaaccggt 102  Q
    |||||| ||| ||| ||||||||||||||||||||| |  ||   ||||||| | ||||||||||||| ||||||||||||    
7921 ggggaaaaacacttggccagtgcgcatgcctctacgcattagctggattagtcgcccacctttggtggatcggaaaccggt 7841  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University