View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1971_high_4 (Length: 251)
Name: NF1971_high_4
Description: NF1971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1971_high_4 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 147 - 251
Target Start/End: Complemental strand, 26958491 - 26958387
Alignment:
| Q |
147 |
gcagaaagaaactgctgagcaaactgctttggttaattctaatggagaatttaaagcaggtatacaaaaatgtccaccataatgcttatcttatctttgt |
246 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26958491 |
gcagaaagaaactgctgagcaagctgctttggttaattctaatggagaatttaaagcaggtatacaaaaatgtccaccataatgcttatcttatctttgt |
26958392 |
T |
 |
| Q |
247 |
ataat |
251 |
Q |
| |
|
||||| |
|
|
| T |
26958391 |
ataat |
26958387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 14 - 118
Target Start/End: Complemental strand, 26958624 - 26958520
Alignment:
| Q |
14 |
ttctcaaggtcatcatttcttgacttgagttgactaattgatatatatgcttataataagtcatcaatcattaactcaagtttttaggaaaaataactca |
113 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26958624 |
ttctcaaggtcaacatttcttgacttgagttgactaattgatatatatgcttataataagtcatcaatcattaactcaagtttttaggaaaaataactca |
26958525 |
T |
 |
| Q |
114 |
ctacc |
118 |
Q |
| |
|
||||| |
|
|
| T |
26958524 |
ctacc |
26958520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University