View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1971_low_4 (Length: 383)
Name: NF1971_low_4
Description: NF1971
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1971_low_4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 142 - 367
Target Start/End: Original strand, 20190844 - 20191070
Alignment:
| Q |
142 |
acctaattaagatcattattgatgcagggttttaggtcatttgtatggacagcaatttcctatcaacttaaagataatcttcatttgacaccctcagctt |
241 |
Q |
| |
|
|||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
20190844 |
acctaattaagaacactattgatgcagggttttaggtcatttgtatggacagcaatttcctatcaacttaaagataatcttcatttgtcaccctcagctt |
20190943 |
T |
|
| Q |
242 |
cccaatttgtgttttcagttgcattttttccatggagcattaagccattatatgggtatgaagag-tttaatttcccctcaattgagtatcatgtattgg |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
20190944 |
cccaatttgtgttttcagttgcattttttccatggagcattaagccattatatgggtatgaatagttttaatttcccctcaattgagtatcatgtattgg |
20191043 |
T |
|
| Q |
341 |
atttagttggtatgtagtgtcagtgta |
367 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
20191044 |
atttagttggtatgtagtgtcagtgta |
20191070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 20 - 55
Target Start/End: Original strand, 20190722 - 20190757
Alignment:
| Q |
20 |
actaacatatgtcggacaccggacaagtaattagaa |
55 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
20190722 |
actaacatatgtcggacaccggacaagtaattagaa |
20190757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University