View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19721_high_14 (Length: 280)
Name: NF19721_high_14
Description: NF19721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19721_high_14 |
 | |
|
| [»] scaffold0200 (1 HSPs) |
| | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0200 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: scaffold0200
Description:
Target: scaffold0200; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 201
Target Start/End: Original strand, 31195 - 31394
Alignment:
| Q |
1 |
atctacaatgaaagaccttaaacaaagccacctactatcaatttgtctaaggaatgggctcaattgagcctctacatcacccctgtagtcatggtttccc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31195 |
atctacaatgaaagaccttaaacaaagccacctactatcaatttgtctaaggaatgggctcaattgagcctctacatcacccctgtagtcatggtttccc |
31294 |
T |
|
| Q |
101 |
aacactgcatgcagatcattaaccatgttattacatttgtaatttatagtcaagaatacaaattactagaaaaagtcctaaattgcggtatacaattaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
31295 |
aacactgcatgcagatcattaaccatgttattacatttgtaatttatagtcaagaatacaaattac-agaaaaaatcctaaattgcggtatacaattaca |
31393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 203 - 280
Target Start/End: Complemental strand, 26615088 - 26615011
Alignment:
| Q |
203 |
aacgatgtaaagattttaaggtttttacaaccgtaatcgtggctgcagttttttcatatgtgtctgatatctgacacg |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
26615088 |
aacgatgtaaagattttaaggtttttacaaccgtaattgtggctgcagttttttcatacgtgtctgatatctgacacg |
26615011 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 49 - 102
Target Start/End: Original strand, 45501566 - 45501619
Alignment:
| Q |
49 |
aaggaatgggctcaattgagcctctacatcacccctgtagtcatggtttcccaa |
102 |
Q |
| |
|
|||||||||||| |||||||| || ||||| || |||||||||||||| ||||| |
|
|
| T |
45501566 |
aaggaatgggcttaattgagcttcaacatctcctctgtagtcatggttgcccaa |
45501619 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University