View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19721_high_17 (Length: 250)
Name: NF19721_high_17
Description: NF19721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19721_high_17 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 18 - 250
Target Start/End: Original strand, 42081949 - 42082182
Alignment:
| Q |
18 |
atcgcaatggtggaaatgtttaagattgatttgctttgaatatatcttttcgaatttaaacttacctgaagatcaatttatcttttcgattttcaatttg |
117 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||| |
|
|
| T |
42081949 |
atcgcaatggtggaactgtttaagattgatttgcttttaatatatcttttcgaatttaaacttacatgaagaacaatttatcttttcgattttcaatttg |
42082048 |
T |
|
| Q |
118 |
gaagttacgatcgttactgttactttgttgagcgattcgtagcagatcatatgttatgtgttgttacacattataacggataatgatgga-tagtgcgag |
216 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
42082049 |
gaagtcacgatcgttactgttactttgttgagcgattcgtaacagatcatatgttatgcgttgttacacattataacggataatgatggattagtgcgag |
42082148 |
T |
|
| Q |
217 |
acttagagcgacgaaattcgagaaaagtagtttt |
250 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
42082149 |
gcttagagcgacgaaattcaagaaaagtagtttt |
42082182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University