View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19721_high_18 (Length: 245)
Name: NF19721_high_18
Description: NF19721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19721_high_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 32 - 231
Target Start/End: Original strand, 16499020 - 16499224
Alignment:
| Q |
32 |
gcttaacatataaagcatatttgcttgttgtgtttcattcacttccatttgttgtataccttgatccatgtgtcaaaaatattatt-aaattgccaacaa |
130 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||| ||| |||| |
|
|
| T |
16499020 |
gcttaacatataaagcatctttgcttgttgtgtttcattcacttccatttgttgtatacgctgatccatgtgtcaaaaatattattaaaatagccgacaa |
16499119 |
T |
 |
| Q |
131 |
aatttgatcaagttgataaaagaact----attcaaaacatatttctgtggcattattgatcaagttgaaaaatatttgtttcttttccgaattcagaaa |
226 |
Q |
| |
|
| |||||||||||||||||||||||| ||||||||||||||||| || ||||||||||||||||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
16499120 |
actttgatcaagttgataaaagaactaatgattcaaaacatatttctatgacattattgatcaagttgaaaaatatttgtttttttcccgaattcagaaa |
16499219 |
T |
 |
| Q |
227 |
atatt |
231 |
Q |
| |
|
||||| |
|
|
| T |
16499220 |
atatt |
16499224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University