View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19721_low_29 (Length: 226)
Name: NF19721_low_29
Description: NF19721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19721_low_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 18 - 210
Target Start/End: Complemental strand, 35748774 - 35748584
Alignment:
| Q |
18 |
gatacttcttttcacagtaaagatttttctttctttccttttctcccaacattcgtgaatcctctatgtaaacatgatgtggcccctggacagggttgct |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35748774 |
gatacttcttttcacagtaaagatttttctttctttccttttctcccaacattcgtgaatcttctatgtaaacatgatgtggcccctggacagggttgct |
35748675 |
T |
 |
| Q |
118 |
cttatttctgtcgtggaactgaaataattgcacatttcatcgtttgatttgatttgatttgag-agtcccacataattgtttgattccttggcc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || | |||||||||| ||||||||||||||||| |
|
|
| T |
35748674 |
cttatttctgtcgtggaactgaaataattgcacatttcatcgtttgatttgatttgat---agtactcccacataaatgtttgattccttggcc |
35748584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University