View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19722_high_25 (Length: 238)
Name: NF19722_high_25
Description: NF19722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19722_high_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 8 - 166
Target Start/End: Complemental strand, 9014688 - 9014530
Alignment:
| Q |
8 |
ataagtgacattggacactccattttagtggttgctataagtgcattgttaatgaaacaagtctatgactgtatggagtattggtgttgtgtttagagat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| || ||||||| ||||||||||||||||||||||| |
|
|
| T |
9014688 |
ataagtgacattggacactccattttagcggttgctataagtgcattgttaatgaaacaagtctacgattgtatggggtattggtgttgtgtttagagat |
9014589 |
T |
 |
| Q |
108 |
aaagatggtgtggtcattgctaccaannnnnnncattaccatattcattggtagcaaaa |
166 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
9014588 |
aaagatggtgtggtcattgctaccaatttttttcattaccatattcattggtagcaaaa |
9014530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 193 - 233
Target Start/End: Complemental strand, 9014515 - 9014475
Alignment:
| Q |
193 |
ctgaaatcttatagcggaataagatgtttttgatgatgtcc |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9014515 |
ctgaaatcttatagcggaataagatgtttttgatgttgtcc |
9014475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University