View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19722_low_25 (Length: 242)
Name: NF19722_low_25
Description: NF19722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19722_low_25 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 16 - 223
Target Start/End: Complemental strand, 12394857 - 12394650
Alignment:
| Q |
16 |
attatgatgtaataaagaaatcaagtttggtgaactacggataatggaatgaccatggctgcatgattcctccatatagaaccacccaattcattggatg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12394857 |
attatgatgtaataaagaaatcaagtttggtgaactacggataatggaatgaccatggctgcatgattcctccatatagaaccacccaattcattggatg |
12394758 |
T |
 |
| Q |
116 |
cctctgctttaacacccaagagtcatgcatgtgtagatgaaaaattgcatcaagtttatgaaatacctacctctagtctgcttctgttagtgttagttct |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12394757 |
cctctgctttaacacccaagagtcatgcatgtgtagatgaaaaattgcatcaagtttatgaaatacctacctctagtctgcttctgttagtgttagttct |
12394658 |
T |
 |
| Q |
216 |
ctctccct |
223 |
Q |
| |
|
|||||||| |
|
|
| T |
12394657 |
ctctccct |
12394650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University