View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19722_low_27 (Length: 232)
Name: NF19722_low_27
Description: NF19722
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19722_low_27 |
 |  |
|
| [»] scaffold0150 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 52154963 - 52155187
Alignment:
| Q |
1 |
ccaatcatgtcattgttgcccaggagtttaactacagtagcaagaggcaagcctagcatgtggagaagaaaatctactacggattttgatgcttcggcaa |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
52154963 |
ccaaccatgtcattgttgcccaggagtttaactacagtagcaagaggcaagcctagcatgtggagaagaaaatctactacggattttgatgcttcagcaa |
52155062 |
T |
 |
| Q |
101 |
aaacaactttctcattctttgtgtctatcagaagtttcagcgtgaatttggagttggaagccattttgaaatattaggtcaaaaacagaagattgaagtt |
200 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52155063 |
aaacaactttctcattctctgtgtctatcagaagtttcagcgtgaatttggagttggaagccattttgaaatattaggtcaaaaacagaagattgaagtt |
52155162 |
T |
 |
| Q |
201 |
tctttgtggctattcattcatctca |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
52155163 |
tctttgtggctattcattcatctca |
52155187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 57 - 125
Target Start/End: Original strand, 52150212 - 52150280
Alignment:
| Q |
57 |
catgtggagaagaaaatctactacggattttgatgcttcggcaaaaacaactttctcattctttgtgtc |
125 |
Q |
| |
|
|||||||||||||| ||||||||| | |||||||| ||| ||||| | ||||||||| ||||||||||| |
|
|
| T |
52150212 |
catgtggagaagaatatctactacaggttttgatgtttcagcaaagagaactttctccttctttgtgtc |
52150280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 67 - 139
Target Start/End: Original strand, 52145743 - 52145815
Alignment:
| Q |
67 |
agaaaatctactacggattttgatgcttcggcaaaaacaactttctcattctttgtgtctatcagaagtttca |
139 |
Q |
| |
|
||||| |||| ||| |||||||| ||||| ||||| | |||||||||||||||||| ||||| ||||| |||| |
|
|
| T |
52145743 |
agaaagtctattacagattttgaagcttcagcaaagagaactttctcattctttgtatctataagaagcttca |
52145815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0150 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0150
Description:
Target: scaffold0150; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 45 - 137
Target Start/End: Complemental strand, 18074 - 17982
Alignment:
| Q |
45 |
aggcaagcctagcatgtggagaagaaaatctactacggattttgatgcttcggcaaaaacaactttctcattctttgtgtctatcagaagttt |
137 |
Q |
| |
|
|||||||| |||||||| || |||||| |||| |||| ||| |||||||| ||||| | |||| | |||||||||||||| || |||||||| |
|
|
| T |
18074 |
aggcaagcatagcatgttgaaaagaaagtctataacgggtttagatgcttcagcaaagagaactctttcattctttgtgtcaataagaagttt |
17982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University