View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19723_high_32 (Length: 310)
Name: NF19723_high_32
Description: NF19723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19723_high_32 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 158; Significance: 4e-84; HSPs: 8)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 18 - 208
Target Start/End: Complemental strand, 1832591 - 1832401
Alignment:
| Q |
18 |
agatatagttgttattgcagatgagttcaaaccttcaacatctttcaaaacatgttcaattcaaaacatattatcaaggacttcatgatttaggctgatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| | |
|
|
| T |
1832591 |
agatatagttgttattgcagatgagttcaaaccttcaacatctttcaaaacatgttcaattcaaaacatattatcaaggacttcatgacttaggctgaat |
1832492 |
T |
 |
| Q |
118 |
aaggttcttgtctcaaaattggataannnnnnncgcatacttaagagataggaagaaatggtaagagctgaatgccgagccgacattcttt |
208 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1832491 |
aaggttcttgtctcaaaattggataatttttttcacatacttaagagataggaagaaatggtaagagctgaatgccgagccgacattcttt |
1832401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 25 - 67
Target Start/End: Complemental strand, 1822226 - 1822184
Alignment:
| Q |
25 |
gttgttattgcagatgagttcaaaccttcaacatctttcaaaa |
67 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
1822226 |
gttgttattgcagatgagttcataccttcaacatctttcaaaa |
1822184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 213 - 254
Target Start/End: Complemental strand, 1832342 - 1832301
Alignment:
| Q |
213 |
atacttttagtaaacactttctcgtacatattttctcctttc |
254 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
1832342 |
atacttttagtaaacactttctcatacatattttctcctttc |
1832301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 26 - 67
Target Start/End: Complemental strand, 1841837 - 1841796
Alignment:
| Q |
26 |
ttgttattgcagatgagttcaaaccttcaacatctttcaaaa |
67 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
1841837 |
ttgttatttcagatgagttcaaaccttcaacatatttcaaaa |
1841796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 174 - 208
Target Start/End: Complemental strand, 1847081 - 1847047
Alignment:
| Q |
174 |
aatggtaagagctgaatgccgagccgacattcttt |
208 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |
|
|
| T |
1847081 |
aatggtaagagctgaattccgagccgacattcttt |
1847047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 67
Target Start/End: Original strand, 6465567 - 6465604
Alignment:
| Q |
30 |
tattgcagatgagttcaaaccttcaacatctttcaaaa |
67 |
Q |
| |
|
||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
6465567 |
tattgcagacgaattcaaaccttcaacatctttcaaaa |
6465604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 264 - 296
Target Start/End: Complemental strand, 1832271 - 1832239
Alignment:
| Q |
264 |
tagtaaccatacctgtcaaggctgcagaataat |
296 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
1832271 |
tagtaaccataccagtcaaggctgcagaataat |
1832239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 176 - 208
Target Start/End: Complemental strand, 1842457 - 1842425
Alignment:
| Q |
176 |
tggtaagagctgaatgccgagccgacattcttt |
208 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
1842457 |
tggtaagagctgaatgccgagccaacattcttt |
1842425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 63 - 113
Target Start/End: Complemental strand, 17849033 - 17848982
Alignment:
| Q |
63 |
caaaacatgttcaattcaaaacatattat-caaggacttcatgatttaggct |
113 |
Q |
| |
|
||||||| |||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
17849033 |
caaaacacattcagttcaaaacatattatacaaggacttcatgatttaggct |
17848982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University