View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19723_high_36 (Length: 258)

Name: NF19723_high_36
Description: NF19723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19723_high_36
NF19723_high_36
[»] chr6 (2 HSPs)
chr6 (10-124)||(8216400-8216514)
chr6 (210-243)||(8216281-8216314)


Alignment Details
Target: chr6 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 10 - 124
Target Start/End: Complemental strand, 8216514 - 8216400
Alignment:
10 atgaaaaatattttttgagagatgtcaatcatttcaatgaatcctaaaaatatctcgattcattggtctccttaattgtgttcataaaataacttgatct 109  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8216514 atgaaaaatattttttgaaagatgtcaatcatttcaatgaatcctaaaaatatctcgattcattggtctccttaattgtgttcataaaataacttgatct 8216415  T
110 aatattttgttttac 124  Q
    |||||||||||||||    
8216414 aatattttgttttac 8216400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 210 - 243
Target Start/End: Complemental strand, 8216314 - 8216281
Alignment:
210 gtattacagggattgtgaataacttggtgtgtag 243  Q
    ||||||||||||||||||||||||||||||||||    
8216314 gtattacagggattgtgaataacttggtgtgtag 8216281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University