View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19723_high_37 (Length: 253)
Name: NF19723_high_37
Description: NF19723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19723_high_37 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 19802109 - 19802329
Alignment:
| Q |
1 |
tgccccagtcagaattgtagtgggaatgacatgcgtctagtattggagacggaagcaacatggggtatcttgttcgcaagctcacgtcatttttactcta |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
19802109 |
tgccccagtcagaattgtagtgggaatgacatgtgtctagtattggagacggaagcaacatggggtatcttgtttgcaagctcacgtcacttttactcta |
19802208 |
T |
 |
| Q |
101 |
taactctcacctgggtttgggtcaaagatagtaaaccttgtgttactttctgagcacatgggctatctcaatgtgggcaagcccataaggtctagagcga |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||| || |
|
|
| T |
19802209 |
taactctcacctgggtttgggtcaaagatagtaaaccttgtgttactttctgagcacatgggctatctcaatgtggg--------------cttgagtga |
19802294 |
T |
 |
| Q |
201 |
aacctacaccatagtataccattttgtctacctat |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
19802295 |
aacctacaccatagtataccattttgtctacctat |
19802329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University