View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19723_high_49 (Length: 231)
Name: NF19723_high_49
Description: NF19723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19723_high_49 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 154; Significance: 8e-82; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 18 - 179
Target Start/End: Complemental strand, 34608284 - 34608123
Alignment:
| Q |
18 |
tattctaactgaactatgttattctgtttgagttagaggcttgtttcagaggtataaataagtctcataggaaatctctatgaggaggggctaaggagac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34608284 |
tattctaactgaactatgttattctgtttgagttagaggcttgtttcagaggtataaataagtctcataggaaatctctatgaggaggggctaaggagac |
34608185 |
T |
|
| Q |
118 |
aaatttggaatcacattgcactttaagttagaattccatgtaactctatgatttgtggtgtt |
179 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34608184 |
aaatttggaatcacgttgcactttaagttagaaatccatgtaactctatgatttgtggtgtt |
34608123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 18 - 161
Target Start/End: Complemental strand, 34594098 - 34593951
Alignment:
| Q |
18 |
tattctaactgaactatgtt---attctgtttgagttagaggcttgtttcagaggtataaataagtctcataggaaatctctatgaggaggggctaagga |
114 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||||||||||| ||||||||||||||||||||| || |||||||| |||| |||||||||| |
|
|
| T |
34594098 |
tattctaactgaactatgttgttattctgtttcagttagaggcttgtttcggaggtataaataagtctcatatgatatctctataaggaagggctaagga |
34593999 |
T |
|
| Q |
115 |
gacaaatttggaatcacattgcact-ttaagttagaattccatgtaac |
161 |
Q |
| |
|
|| |||||||||||||||||||| | | ||||||||| |||||||||| |
|
|
| T |
34593998 |
gaaaaatttggaatcacattgcagtgtgaagttagaaatccatgtaac |
34593951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University