View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19723_high_51 (Length: 214)
Name: NF19723_high_51
Description: NF19723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19723_high_51 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 139; Significance: 6e-73; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 42 - 200
Target Start/End: Complemental strand, 7429129 - 7428971
Alignment:
| Q |
42 |
ctttgtttataaatagtgtgtaaaaatcatctcaacgaacaatcaatcaatcaaatcaaaatgtggttttaatcttaatttactcgttataattttgcat |
141 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| ||||||||||||||||| |||||||| |
|
|
| T |
7429129 |
ctttgtctataaatagtgtgtaaaaatcatctcaacgaacaatcaatcaatcaaatcaaaatatgattttaatgttaatttactcgttatatttttgcat |
7429030 |
T |
|
| Q |
142 |
ttgatttacttctgcttaattttattaatttaatatttctcaaaaactcaacaatcttg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7429029 |
ttgatttacttctgcttaattttattaatttaatatttctcaaaaactcaacaatcttg |
7428971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University