View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19723_high_55 (Length: 206)
Name: NF19723_high_55
Description: NF19723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19723_high_55 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 1 - 100
Target Start/End: Complemental strand, 44494779 - 44494680
Alignment:
| Q |
1 |
aagaaaattataatattaaaatttaatcgagtattgtttgtttatgttttaacaacattatatcaaccgatgaaaagacagatattatacatgccatcac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44494779 |
aagaaaattataatattaaaatttaatcgagtattgtttgtttatgttttaacaacattatatcaaccgatgaaaagacagatattatacatgccatcac |
44494680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University