View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19723_low_32 (Length: 322)
Name: NF19723_low_32
Description: NF19723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19723_low_32 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 150; Significance: 3e-79; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 128 - 310
Target Start/End: Complemental strand, 48685133 - 48684939
Alignment:
| Q |
128 |
attgttttagtcccaaaacaagagagaaaaaatgttttctcaatag------------tggtcgtacaaatatcatttttctaaataaaaagaagacaaa |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48685133 |
attgttttagtcccaaaacaagagagaaaaaatgttttctcaaaagatgactcaataatggtcgtacaaatatcatttttctaaataaaaagaagacaaa |
48685034 |
T |
|
| Q |
216 |
tcttctaaatatggcagtaacatgatagaaattgtaaaagcaagttctctgtcatgtctaggtaaaataatgaaattgaaacatcttaccagaat |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48685033 |
tcttctaaatatggcagtaacatgatagaaattgtaaaagcaagttctctgtcatgtctaggtaaaataatgaaattgaaacatcttaccagaat |
48684939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 16 - 45
Target Start/End: Complemental strand, 48685231 - 48685202
Alignment:
| Q |
16 |
ctttatcctcaaaatcctcatctctctttt |
45 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
48685231 |
ctttatcctcaaaatcctcatctctctttt |
48685202 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University