View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19723_low_33 (Length: 311)
Name: NF19723_low_33
Description: NF19723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19723_low_33 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 1 - 300
Target Start/End: Complemental strand, 19802121 - 19801821
Alignment:
| Q |
1 |
tctgactggggcacacatcgtctttgttgctgcaatctatggtgtgtacgttgtccctgctgcaagcccatgtggtgtgtgtatcgttgttctgcaaacc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
19802121 |
tctgactggggcacacatcgtctttgttgctgcaatctatggtgtgtacgttgtccctgctgcaagcccatgtggtgtgtgtatcgttgttctgcgaacc |
19802022 |
T |
 |
| Q |
101 |
ctttggtgtgtacgtcctatgatgcc-tttaagcagcacagtctgtgaatggaattgttgagggcgccgcaagaaagattgaaacaagtgaataaccaga |
199 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19802021 |
ctttggtgtgtacgtcctatgatgccatttaagcagcacagtctgtgaatggaattgttgagggcgccgcaagaaagattgaaacaagtgaataaccaga |
19801922 |
T |
 |
| Q |
200 |
aagaggttgtacgttatgcttattctttccatttgtataattgttttgggaggaaagttcataggtttggtgttaaaatggtgccacatgatctgtatat |
299 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19801921 |
aagaggttgtacgttttgcttattctttccatttgtataattgttttgggaggaaagttcatgggtttggtgttaaaatggtgccacatgatctgtatat |
19801822 |
T |
 |
| Q |
300 |
t |
300 |
Q |
| |
|
| |
|
|
| T |
19801821 |
t |
19801821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University