View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19723_low_38 (Length: 258)
Name: NF19723_low_38
Description: NF19723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19723_low_38 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 10 - 124
Target Start/End: Complemental strand, 8216514 - 8216400
Alignment:
| Q |
10 |
atgaaaaatattttttgagagatgtcaatcatttcaatgaatcctaaaaatatctcgattcattggtctccttaattgtgttcataaaataacttgatct |
109 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8216514 |
atgaaaaatattttttgaaagatgtcaatcatttcaatgaatcctaaaaatatctcgattcattggtctccttaattgtgttcataaaataacttgatct |
8216415 |
T |
 |
| Q |
110 |
aatattttgttttac |
124 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
8216414 |
aatattttgttttac |
8216400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 210 - 243
Target Start/End: Complemental strand, 8216314 - 8216281
Alignment:
| Q |
210 |
gtattacagggattgtgaataacttggtgtgtag |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
8216314 |
gtattacagggattgtgaataacttggtgtgtag |
8216281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University