View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19723_low_45 (Length: 241)
Name: NF19723_low_45
Description: NF19723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19723_low_45 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 2 - 138
Target Start/End: Original strand, 514374 - 514510
Alignment:
| Q |
2 |
agaagaagaagaagatgatgatcgatattaagaaatattggactaagaacacattaattggtcttgttttaggtcaatttctttctcttctcattactgc |
101 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
514374 |
agaagaagaagaagatgattatcgatattaagaaatattggactaagaacacattaattggtcttgctttaggtcaatttctttctcttctcatcactgc |
514473 |
T |
|
| Q |
102 |
tactggtttcgcttcttctgatttagctaaaaaaggt |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
514474 |
tactggtttcgcttcttctgatttagctaaaaaaggt |
514510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University