View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19723_low_50 (Length: 235)
Name: NF19723_low_50
Description: NF19723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19723_low_50 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 17 - 221
Target Start/End: Original strand, 44494757 - 44494961
Alignment:
| Q |
17 |
aattttaatattataattttcttaagaggctaaaagcaaaatttatcatacaacttaaaaatggattcacttaattgctaggaaataaaacccacataag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44494757 |
aattttaatattataattttcttaagaggctaaaagcaaaatttatcatacaacttaaaaatggattcacttaattgctaggaaataaaacccacataag |
44494856 |
T |
 |
| Q |
117 |
ttaatatgatatgccaaaaattaactaaattatagtataaaatataaaaaagagaatagtgtattaacatttaacggtgcagttaaatattacccctggc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44494857 |
ttaatatgatatgccaaaaattaactaaattatagtataaaatataaaaaagagaatagtgtattaacatttaacggtgcagttaaatattacccctggc |
44494956 |
T |
 |
| Q |
217 |
ctttg |
221 |
Q |
| |
|
||||| |
|
|
| T |
44494957 |
ctttg |
44494961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University