View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF19723_low_54 (Length: 214)

Name: NF19723_low_54
Description: NF19723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF19723_low_54
NF19723_low_54
[»] chr1 (1 HSPs)
chr1 (42-200)||(7428971-7429129)


Alignment Details
Target: chr1 (Bit Score: 139; Significance: 6e-73; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 42 - 200
Target Start/End: Complemental strand, 7429129 - 7428971
Alignment:
42 ctttgtttataaatagtgtgtaaaaatcatctcaacgaacaatcaatcaatcaaatcaaaatgtggttttaatcttaatttactcgttataattttgcat 141  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| ||||||||||||||||| ||||||||    
7429129 ctttgtctataaatagtgtgtaaaaatcatctcaacgaacaatcaatcaatcaaatcaaaatatgattttaatgttaatttactcgttatatttttgcat 7429030  T
142 ttgatttacttctgcttaattttattaatttaatatttctcaaaaactcaacaatcttg 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7429029 ttgatttacttctgcttaattttattaatttaatatttctcaaaaactcaacaatcttg 7428971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University