View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19724_high_16 (Length: 206)
Name: NF19724_high_16
Description: NF19724
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19724_high_16 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 17 - 206
Target Start/End: Complemental strand, 42961175 - 42960986
Alignment:
| Q |
17 |
gggggtgattttcaaggatgaaaatgggaaacagcataaggcaatactaggaaatgatagggagagtgaagtgattgtgtctagtggggcaattggaact |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42961175 |
gggggtgattttcaaggatgaaaatgggaaacagcataaggcaatactaggaaatgatagggagagtgaagtgattgtgtctagtggggcaattggaact |
42961076 |
T |
 |
| Q |
117 |
cctcaaatgctattactcagtggaattggcccaaaagcagaacttgagaacttgaaaatccctgtggtacttgacaacagatttgttggg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42961075 |
cctcaaatgctattactcagtggaattggcccaaaagcagaacttgagaacttgaaaatccctgtggtacttgacaacagatttgttggg |
42960986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 68; Significance: 1e-30; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 18 - 193
Target Start/End: Original strand, 5503529 - 5503704
Alignment:
| Q |
18 |
ggggtgattttcaaggatgaaaatgggaaacagcataaggcaatactaggaaatgatagggagagtgaagtgattgtgtctagtggggcaattggaactc |
117 |
Q |
| |
|
||||| |||||||| ||||||||||||||||| ||| |||||| | |||||||||| | | ||||||||||| ||||||||||||||||||| ||| |
|
|
| T |
5503529 |
ggggttattttcaatgatgaaaatgggaaacaacatgaggcaaggttgggaaatgatatgcaaagtgaagtgatattgtctagtggggcaattgggtctc |
5503628 |
T |
 |
| Q |
118 |
ctcaaatgctattactcagtggaattggcccaaaagcagaacttgagaacttgaaaatccctgtggtacttgacaa |
193 |
Q |
| |
|
||||||||||||| || ||||||||||| || |||| |||||| |||||||||| ||| | ||||| ||| |||| |
|
|
| T |
5503629 |
ctcaaatgctattgctaagtggaattggtcctaaagatgaacttcagaacttgaacatctcagtggtccttaacaa |
5503704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University