View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF19724_low_11 (Length: 292)
Name: NF19724_low_11
Description: NF19724
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF19724_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 10 - 277
Target Start/End: Complemental strand, 42715143 - 42714876
Alignment:
| Q |
10 |
attattctatttcagttacttaacttacttctattgaagtgttggctcgttcaatggaggtgttttggttccaagtattggctcattttctattgaagtg |
109 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||||| ||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
42715143 |
attattctatttcagttacataactttcttctattgaagtattggctcattcaatggaggtgttttggttccaagtattgggtcattttctattgaagtg |
42715044 |
T |
|
| Q |
110 |
taaaattggggtgactttttataagggaggcattagggttgtgttgtaaattggaatttgttgatttgtctaactagattagctttggtggggttcaata |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
42715043 |
taaaattggggtgactttttataagggaggcattagggttgtgttgtaaattggaatttgttgatttgtctaactagattagctttggcggggttcaata |
42714944 |
T |
|
| Q |
210 |
gctcatactttagccttggtaaactaattggttgtttttatcaattttcaactgatgggataaatact |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42714943 |
gctcatactttagccttggtaaactaattggttgtttttatcaattttcaactgatgggataaatact |
42714876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University